Labshake search
Citations for Addgene :
1801 - 1850 of 2662 citations for Recombinant Human Epithelial Cell Adhesion Molecule His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... HEK293T cells were transfected with viral packaging plasmids psPAX2 Addgene #12260) and pMD2.G (Addgene#12259), and pLKO.1 shRNA using Lipofectamine 3000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2023Quote: pPGK-Cre lentiviral backbone was amplified and transfected into 293T cells using VSV-G (Addgene 8454) and psPAX2 (Addgene 12260 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The constructs were PEI transfected into HEK293T cells along with psPAX2 lentiviral packaging construct (Addgene #12259) and pMD2.G envelope construct (Addgene #12259) ...
-
The Hippo pathway terminal effector TAZ/WWTR1 mediates oxaliplatin sensitivity in colon cancer cellsbioRxiv - Cancer Biology 2023Quote: Murine Taz was expressed by transfecting cells with pEF-TAZ-N-Flag from Michael Yaffe (Addgene #19025 ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were co-transfected with two gRNAs and pSpCas9n(BB)-2A-Puro (PX462) V2.0 (Addgene, 62987). After 24 h the cells were selected with puromycin and expanded ...
-
bioRxiv - Genomics 2023Quote: ... HEK293T cells were co-transfected with two packaging plasmids (pCMV-VSV-G and delta8.9, Addgene #8454) and either a desired transfer plasmid ...
-
bioRxiv - Genomics 2022Quote: ... HEK-293T cells were transfected with shRNA constructs and lentiviral packaging constructs pMD2.G (Addgene #12259) and psPAX2 (Addgene #12260) ...
-
bioRxiv - Cell Biology 2023Quote: We quantified the fluorescence of cells transduced with pFU-GW-sMYH6-mScarlet-TNNT2-mNeon (Addgene 170712) and ORF cDNA-expressing transcription factors on reprogramming day 6 ...
-
bioRxiv - Cancer Biology 2022Quote: MMS22L-KO and AAVS1 control cells were infected with lentiviruses generated using LV-GFP (Addgene #25999) or LV-RFP (Addgene #26001 ...
-
bioRxiv - Genetics 2023Quote: ... Muscle cells were then transfected with a pLenti-myc-GLUT4-mCherry (Addgene; Watertown, MA; stock # 64049) for 48 hours and the GLUT4 localization assay was performed as previously described(Lim ...
-
bioRxiv - Developmental Biology 2023Quote: ... CRIPSRi activity in each cell line was validated by lentiviral transduction with pCRISPRia-v2 (Addgene #84832) backbones containing either a guide RNA (gRNA ...
-
bioRxiv - Systems Biology 2022Quote: A549 cells were stably transduced with lentivirus from lentiCas9-Blast (Addgene #52962, gift from Feng Zhang) and subsequently selected using blasticidin ...
-
bioRxiv - Cancer Biology 2023Quote: ... A673 cells were infected with pLV-EF1a-RNAseH1-IRES-Blast lentivirus (derived from Addgene plasmid #85133) or empty vector and selected for stably infected cells.
-
bioRxiv - Cancer Biology 2023Quote: Lentivirus were generated by transfecting 293T cells with the indicated expression plasmid and the psPAX2 (Addgene) and pVSVG (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: SNAIL and SLUG knockout PANC-1 cell lines were generated using lentiCas9-Blast (Addgene plasmid 52962) and lentiGuide-Puro (Addgene plasmid 52963 ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were co-transfected using polyethylenimine (PEI) with Cas9 (pU6-CBh-Cas9-T2A-BFP: Addgene 64323) and gRNA-Puro (pKLV2.2-h7SKgRNA-hU6gRNA-PGKpuroBFP ...
-
bioRxiv - Molecular Biology 2023Quote: ... The stable cell line was then transduced with sgRNA-expression vectors LRG (Lenti_sgRNA_EFS_GFP; Addgene plasmid #65656) with gRNAs for IRF2BP2 ...
-
bioRxiv - Developmental Biology 2024Quote: The KO cell lines were generated by co-transfecting pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene 42230) with two sgRNAs (sequences see table below) ...
-
bioRxiv - Synthetic Biology 2024Quote: Ligands were cloned into a pcDNA backbone to confer high expression in HEK293FT cells (Addgene #138749)26 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviruses were produced using a similar procedure with 293T cells using the psPAX2 plasmid (Addgene, 12260) instead of pUMVC.
-
bioRxiv - Microbiology 2023Quote: ... cells were co-transfected with 0.5 μg of pCMV(CAT)T7-SB100 (transposase vector; Addgene, 34879) and 5 μg of pSBbi or pSBtet containing gene of interest using TransIT-LT1 transfection reagent (Mirus Bio) ...
-
bioRxiv - Molecular Biology 2023Quote: ... with 3 million K562 cells and 10 µg of pCMV-PE2-tagRFP-BleoR (Addgene no. 192508) per individual electroporation (Day 0) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The control and ERBB2 OE cells were generated using retroviral vectors pBABE-puro (Addgene, cat# 1764) and pBABEpuro-ERBB2 (Addgene ...
-
bioRxiv - Bioengineering 2023Quote: HEK293T cells were transfected with ACE2- and TMPRSS2-expression plasmids (RRID: Addgene_141185 and RRID: Addgene_145843, respectively) to allow infection by pseudo-viruses as previously described [12] ...
-
bioRxiv - Cancer Biology 2023Quote: ... 293FT cells were co-transfected using (per condition) 3 µg of pLKO.GFP transfer plasmid (Addgene, #30323) containing the shRNA (sequences in Supplementary Table S6) ...
-
bioRxiv - Immunology 2023Quote: ... mouse naïve CD4+ T cells were transfected with p8xEGFP-N1 (Addgene # 122168, gift from Georg Mayr) which expresses 8 concatemeric EGFP proteins ...
-
bioRxiv - Genetics 2023Quote: Prime editing experiments in K562 and Jurkat cell lines were performed with pCMV-PEmax (Addgene 174820). The ATP1A1-Q118R_v2 epegRNA11 was cloned into pU6-tevopreq1-GG-acceptor (Addgene 174038 ...
-
bioRxiv - Genetics 2024Quote: ... After 24h cells were transfected with 8,750ng of indicated vector and 8,750ng of psPAX2 (Addgene#12260) and 875ng of pMD2.G (Addgene#12259 ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were then reinfected on DIV 10 with AAV9-mCherry (pENN.AAV9.CB7.CI.mCherry.WPRE.RBG, Addgene #105544-AAV9). Cells were fixed on DIV 18 and endogenous mCherry fluorescence was imaged using a Nikon C2 scanning confocal microscope ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were transduced with lentivirus generated from plasmid UCOE-SFFV-dCas9-BFP-KRAB (Addgene plasmid #85969) as described above ...
-
bioRxiv - Cancer Biology 2024Quote: ... cell lines were transiently transfected with a membrane-targeted fluorescent protein (glycosylphosphatidylinositol-anchored eGFP, Addgene #32601) using a TransIT-X2 transfection kit (Mirus) ...
-
bioRxiv - Cancer Biology 2024Quote: Each pool of the library was transduced into MeWo melanoma cells stably expressing rtTA (Addgene #26429) using conditions that predominantly lead to a single retroviral integration and represent each shRNA in a calculated number of 9,600 cells (a total of 1.2 million cells at infection ...
-
bioRxiv - Immunology 2024Quote: ... HEK293T cells were transfected with the lentiviral vector pScalps-EGFP-Cre recombinase (7) (Addgene plasmid 207132) together with the packaging vectors psPAX2 and pMD2.G (Addgene plasmids 12260 and 12259 by Didier Trono ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... MYO3 and MYO5 SH3-deleted yeast competent cells were co-transformed with pCAS (Addgene plasmid 60847) containing the stuffer-specific gRNA and Streptococcus pyogenes Cas929 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... MYO3 and MYO5 SH3-deleted yeast competent cells were co-transformed with pCAS (Addgene plasmid 60847) containing the stuffer-specific gRNA and Streptococcus pyogenes Cas9 with the PCR amplified MYO3 and MYO5 SH3 single position mutated libraries from the pUC19 preparations acting as the donor DNA29 ...
-
bioRxiv - Immunology 2024Quote: Stably expressing H2B-GFP RPE1 WT and SP110-/- cells were generated using lentivirus generated from Addgene plasmid #91788 (Courtesy of Beverly Torok-Storb) ...
-
bioRxiv - Cancer Biology 2024Quote: ... After 32 hours cells were transfected with an equimolar mix of CK2α/β plasmid (Addgene; #27093) and the relevant MCAM tail variant ...
-
bioRxiv - Cancer Biology 2021Quote: ... MCF7 and MCF7-F cells were infected with pLenti-CMV-puro-Luc lentiviral luciferase construct (Addgene 17477) to monitor tumor growth ...
-
bioRxiv - Molecular Biology 2019Quote: ... dCas9-expressing cells were then infected with the MS2-P65-HSF1 activator helper complex (Addgene, 61426-LVC) and treated with 0.5 mg/ml hygromycin ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were transfected by JetPEI (Ozyme) according to manufacturer’s instructions with either an empty px330 plasmid (Addgene) coding only for Cas9 or a px330 plasmid coding for Cas9 and a sgRNA targeting rDNA [13] ...
-
bioRxiv - Immunology 2021Quote: ... GL261-OVA was generated by transducing parent cells with ovalbumin cloned from pcDNA3-OVA (Addgene plasmid # 64599). Transduction was performed as described (85) ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293 cells were transfected with 4µg shRNA p53-puromycin (Fachinetti Lab) + 4µg pMD2.G (12259 from Addgene, RRID:Addgene_12259) + 4µg psPAX2 (12260 from Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... new lentiviral particles were produced by transfecting HEK293 cells with 4µg Apple-53BP1trunc (69531 from Addgene, RRID:Addgene_69531) + 4µg pMD2.G (12259 from Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... new lentiviral particles were produced by transfecting HEK293 cells with 4µg Apple-53BP1trunc (69531 from Addgene, RRID:Addgene_69531) + 4µg pMD2.G (12259 from Addgene ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were transiently transfected with pRK5-myc-Rac1-Q61L (Addgene plasmid # 12983; http://n2t.net/addgene:12983; RRID:Addgene_12983) with Lipofectamine (ThermoFisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... Each sgRNA lentiviral construct was transfected into HEK 293T cells along with packaging vectors psPAX2 (Addgene #12260) and pCMV-VSV-G (Addgene #8454 ...
-
bioRxiv - Cell Biology 2022Quote: ... WT and FIP200 KO HeLa cells were cotransfected with the DNA fragment and the PX459 (Addgene #48139)-based plasmid expressing Cas9 and gRNA (GTCTTAGAAGCCGTGAGGTA for the NCOA4 gene ...
-
bioRxiv - Microbiology 2020Quote: ... the mouse cDNA sequence of IRE1 from MEF cells was inserted into pcDNA3- EGFP plasmid (Addgene #13031), resulting in fusion proteins with the EGFP fused to the carboxy terminus of IRE1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... For expression in Drosophila S2 cells (68) the mtSSB coding sequence was cloned into pMT-puro (Addgene) using a two-step procedure ...
-
bioRxiv - Cell Biology 2020Quote: ... the Cas9 and mCherry for detection of electroporated cells were obtained from Addgene (plasmids #66939, #66940, #66941). All targeting constructs (for both HDR and NHEJ ...