Labshake search
Citations for Addgene :
1601 - 1650 of 2662 citations for Recombinant Human Epithelial Cell Adhesion Molecule His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were also stably transfected with GFP-CD63 and mCherry-CD81 plasmids (Addgene, USA) for exosomal tracking ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cells were sequentially transduced with lentiviruses of the lentiCRISPR-Puro (Addgene plasmid #52961) expressing Tp53 sgRNA (CCTCGAGCTCCCTCTGAGCC ...
-
bioRxiv - Cancer Biology 2024Quote: H1299 cells were engineered with stable Cas9 expression using Lenti-Cas9-blast (Addgene #52962). Efficient nuclease activity was confirmed using a reporter system (Addgene #67979 ...
-
bioRxiv - Cancer Biology 2024Quote: HT29 cells previously infected with pLenti-U6-tdTomatato-P2A-BlasR (LRT2B) virus (Addgene, 1108545) that enables dual production of firefly luciferase and TdTomato were used ...
-
bioRxiv - Cell Biology 2024Quote: CRISPR-based knockout cell lines were generated using the lentiCRISPRv2 vector obtained from Addgene, which expresses a single guide RNA ...
-
bioRxiv - Cell Biology 2024Quote: ... Both Flox and iKO cells were transfected with 600ng of tfLC3 plasmid (Addgene, 21704) using Lipofectamine LTX (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... HEK293T cells were co-transfected with the second-generation packaging plasmid psPAX2 (Addgene #12260), envelope plasmid VSV-G (Addgene #12259 ...
-
bioRxiv - Biophysics 2023Quote: ... HEK293T cells were co-transfected with the second-generation packaging plasmid psPAX2 (Addgene #12260), envelope plasmid VSV-G (Addgene #12259 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Trp53- conditional LUAD cells were stably transfected with vectors pLUC (Cag.Luc.puro, Addgene ID 74409, RRID:Addgene_74409) or with vectors encoding CRE recombinase pCRE (pPy-CAG- Cre::ERT2-IRES-BSD ...
-
bioRxiv - Cancer Biology 2021Quote: ... Trp53- conditional LUAD cells were stably transfected with vectors pLUC (Cag.Luc.puro, Addgene ID 74409, RRID:Addgene_74409) or with vectors encoding CRE recombinase pCRE (pPy-CAG- Cre::ERT2-IRES-BSD ...
-
bioRxiv - Cell Biology 2021Quote: ... then cells were transfected with 9 µg of each of pMXs-Oct4 (Addgene Plasmid #13366), pMXs-Sox2 (Addgene Plasmid #13367) ...
-
bioRxiv - Molecular Biology 2021Quote: ... BJ EHLT were obtained by retroiviral transduction of BJ cells with hTERT (Addgene plasmid #1773) and Large T SV40 antigen (Addgene plasmid # 21826 ...
-
bioRxiv - Cancer Biology 2022Quote: ... was co-transfected into 80% confluent lenti-X 293T cells with 4.8 μg psPAX2 (Addgene) and 3.2 μg pMD2.G (Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: ... HEK293T cells were transfected with the transfer vector and the packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) ...
-
bioRxiv - Neuroscience 2021Quote: HeLa cells were plated on glass coverslips and transfected with PSD95-tRFP (Plasmid #52671, Addgene) and/or EGFP-tagged SynGAP C-terminal constructs (EGFP-CCα1 or EGFP-CCPBM plasmids (made in house ...
-
bioRxiv - Molecular Biology 2021Quote: ... Lentivirus was produced in HEK293T cells using a 2nd generation lentiviral packaging system (psPAX2 – Addgene plasmid #12260 and pMD2.G – Addgene #12259 from Didier Trono ...
-
bioRxiv - Microbiology 2019Quote: ... Cells were transfected with intracellular markers for the plasma membrane (LCK-GFP; Addgene plasmid #61099), endoplasmic reticulum (pLV-ER GFP ...
-
bioRxiv - Immunology 2019Quote: ... We transfected constructs into HEK293T cells along with lentivirus packaging vector pSPAX2 (Addgene plasmid #12260) and lentivirus envelope vector VSV-G (Addgene plasmid #8454) ...
-
bioRxiv - Cell Biology 2019Quote: ... DHPC-018 cells were infected at passage 20 with lentivirus expressing FUGW-eGFP (Addgene, #14883), then sorted on a FACS Aria II cell sorter for GFP fluorescence ...
-
bioRxiv - Cancer Biology 2020Quote: ... to co-transfect 293T cells with a lentiviral or retroviral plasmid and pantropic VSVg (Addgene) and either psPAX2 (Addgene ...
-
bioRxiv - Cancer Biology 2019Quote: ... Pfeiffer cells (ATCC CRL-2632) were transduced with lentiviral particles produced using vector pMH0001 (Addgene #85969 ...
-
bioRxiv - Cancer Biology 2020Quote: ... ID8 cells were subsequently transfected with luciferase containing construct pHIV-Luciferase #21375 4.5 µg (Addgene) to generate the ID8-luc cells ...
-
bioRxiv - Bioengineering 2021Quote: ... Viral particles were produced in HEK293T packaging cell line by triple transfection with psPAX2 (Addgene #12260 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Lentivirus was produced using HEK293FT cells with the second-generation packaging system pSPAX2 (Addgene plasmid) and pMD2.G (Addgene plasmid) ...
-
bioRxiv - Cell Biology 2021Quote: ... All cell lines were generated using the lentivirus Trono group second generation packaging system (Addgene) and selected using puromycin resistance (1 µg/ml ...
-
bioRxiv - Biochemistry 2021Quote: ... coli cells using pET21a plasmid (a gift from Michael J Fox Foundation, Addgene plasmid # 51486) and was purified at 4 ℃ as previously described.29 Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... HEK293T cells were co-transfected with the packaging vector psPAX2 (#12259, Addgene, Watertown, MA, USA), the envelope vector pMD2.G (#12260 ...
-
bioRxiv - Genetics 2019Quote: ... HEK293T cells were transiently transfected with pGAG/POL (gift from Tannishtha Reya (Addgene plasmid #14887) and pMD2.G (gift from Didier Trono (Addgene plasmid #12259 ...
-
bioRxiv - Neuroscience 2021Quote: ... 1×106 cells were electroporated with 1.5 µg each of pCXLE-hsk (Addgene plasmid #27078), pCXLE-hul (Addgene plasmid #27080 ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were co-transfected with 1 μg of plasmid encoding Perceval HR (Addgene ID:49083) and 100 nM of DIMT1 siRNA at 50% cell confluency ...
-
bioRxiv - Neuroscience 2021Quote: MSCV (Murine Stem Cell Virus)-CreERT2 puro plasmid was a gift from Tyler Jacks (Addgene, Watertown ...
-
bioRxiv - Cancer Biology 2020Quote: HT29 cells were infected with the pLenti-U6-tdTomato-P2A-BlasR (LRT2B) virus (Addgene, 1108545) that enables dual production of firefly luciferase and dTomato ...
-
bioRxiv - Cell Biology 2021Quote: Lentivirus was generated in 293T cells using delta 8.9[45] and pHCMV-EcoEnv (Addgene 15802)[46] as packaging plasmids and 25kDa linear PEI as a transfection agent ...
-
bioRxiv - Cancer Biology 2021Quote: ... we also transfected the cells with a GFP expressing vector (pEGFP-N1, Addgene #6085-1). Fluorescence images were captured with a Nikon Eclipse TE2000 inverted microscope (Nikon ...
-
bioRxiv - Microbiology 2022Quote: A549 cells were stably lentivirally transduced with Cas9-Blast (Addgene #52962, gift from Feng Zhang) and subsequently selected using blasticidin ...
-
bioRxiv - Genomics 2022Quote: ... Cells were transfected with 1.5 µg of psPAX2 (Addgene; 12260, a gift from Didier Trono), 0.15 µg of pMD2.G (Addgene ...
-
bioRxiv - Genetics 2022Quote: Lentivirus was produced in HEK293T cells using the third-generation packaging plasmids (Addgene #12260, #12259). Multiple densities (200,000-600,000 cells ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transfected with 5 μg of mEmerald-Kinesin11-N-18 plasmid (Addgene number: 54137) 24 hours prior to imaging ...
-
bioRxiv - Cancer Biology 2022Quote: ... 293T cells were co-transfected with pBABE-puro-SV40-LT target plasmid (Addgene, Plasmid #13970) together with psPAX2 (Addgene ...
-
bioRxiv - Microbiology 2020Quote: Huh-7.5-Cas9 cells were generated by lentiviral transduction of lentiCas9-Blast (Addgene, cat. #52962) followed by selection and expansion in the presence of 5 µg/ml blasticidin ...
-
bioRxiv - Neuroscience 2021Quote: HEK293T cells were transfected with an inducible nuclear-localized HT protein (HT-NLS, Addgene #82518). Doxycycline (DOX ...
-
bioRxiv - Bioengineering 2022Quote: SLC46A3 knock-out T47D cell lines were generated by infection with lentiCRISPRv2-Opti (Addgene # 163126) vectors encoding Cas9 and single guide RNAs (sgRNAs).(67 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The HN30 and HN31 cell lines were transfected with 2 μg mCherry (Addgene, Plasmid 41583) as a negative control ...
-
bioRxiv - Cancer Biology 2022Quote: SK-N-DZ cells were transduced with lentiviral particles encoding LRP8 gRNAs (lentiCRISPRv2 blast, Addgene plasmid #98293 was a gift from Brett Stringer) ...
-
bioRxiv - Microbiology 2022Quote: VSV-G pseudotyped lentivirus was prepared by transfecting 293T cells with pMD2.G (Addgene 12259), pLX304 (Addgene 25890 ...
-
bioRxiv - Developmental Biology 2022Quote: ... cells were co-transfected with an additional secreted BirA ligase plasmid (50) (Addgene ID 64395) included in the transfection mixture at a ratio of 10 μg DNA:22 μg PEI ...
-
PALP: An imaging method for detecting and quantifying polyunsaturated phospholipids via peroxidationbioRxiv - Cell Biology 2020Quote: Cells were engineered for constitutive Cas9 expression using the pLX-311-Cas9 vector (Addgene 96924), which contains the blasticidin S-resistance gene driven by the SV40 promoter and the SpCas9 gene driven by the EF1 α promoter ...
-
bioRxiv - Cancer Biology 2019Quote: ... lentiviral vector to tag the nucleus of HFF1 cells was purchased from Addgene (Plasmid #21210). Trypsin/EDTA was purchased from Thermo Fisher Scientific (R001100) ...
-
bioRxiv - Genetics 2020Quote: ... Lentiviruses were produced in 293T cells by cotransfection of lentiviral constructs with packaging plasmids (Addgene) for 48–72 hr ...
-
bioRxiv - Cell Biology 2019Quote: HeLa cells were transfected with GFP-ITSN2-S and TagRFP-T-EEA1 (Addgene, reference: 42635) and observed under spinning disk microscope (Zeiss Axio Observer Z1 with a Yokogawa CSU X1 confocal head ...