Labshake search
Citations for Addgene :
2051 - 2100 of 2862 citations for Recombinant Human Epithelial Cell Adhesion Molecule His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Lentivirus particles were packaged in 293T cells by co-transfecting carrier plasmids with psPAX (Addgene, plasmid 12260) and psPAX2 (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... melanoma cells were infected with a lentivirus made using pHAGE-PGK-GFP-IRES-LUC-W (Addgene # 46793) containing coding sequences for green-fluorescent protein and firefly luciferase ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293T cells were transfected with a lentiviral vector and the packaging plasmids pCMV-VSV-G (Addgene, 8454) and psPAX2 (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... USP10 KO cell lines: The selected sgRNA sequence (GCCTGGGTACTGGCAGTCGA) were cloned into Lenti-Cas9-puro vectors (Addgene). HEK293T or SW480 cells stably expressing Lenti-Cas9-puro sgUSP10 were generated following lentiviral infection and puromycin resistance selection ...
-
bioRxiv - Cell Biology 2022Quote: ... we co-transfected HEK293-FT cells with plasmids of interest with VSVG (pMD2.G; Addgene plasmid 12259) and psPAX2 (Addgene plasmid 12260 ...
-
bioRxiv - Genomics 2022Quote: Knock-out cell lines were generated using the lentiCRISPRv2 CRISPR-Cas9 knock-out vector (Addgene no. 52961). Inducible knock-out cell lines were produced with the TLCV2 CRISPR-Cas9 backbone (Addgene no ...
-
bioRxiv - Immunology 2022Quote: ... cells were transduced with a lentiviral dCas9-HA-BFP-KRAB-NLS expression vector (Addgene plasmid no.102244).
-
bioRxiv - Molecular Biology 2022Quote: ... and cells were transfected with 500 ng of CAG-Cas9-T2A-EGFP-ires-puro-plasmid (Addgene, #78311) and with 250 ng of gRNAs altogether using PEI transfection reagent with addition of 0.15 M NaCl ...
-
bioRxiv - Cancer Biology 2024Quote: HEK-293T cell line was transduced with a Cas9 lentiviral vector with blasticidin selection marker (Addgene# 52962) and selected with blasticidin (8 ug/ml) ...
-
bioRxiv - Cancer Biology 2024Quote: ... L363 and KMS12 cells were transduced with the lentiviral vector pInducer20 (RRID:Addgene 44012, Gift of Stephen Elledge) harboring a Tet operator-controlled KDM6A cDNA (pKDM6A ...
-
bioRxiv - Cancer Biology 2024Quote: ... MEF cells were transduced with the retroviral vector pBABE-puro-KRASG12V (Gift from Christopher Counter (RRID:Addgene 46746) or a control plasmid pBABE-puro (Gift from Hartmut Land ...
-
bioRxiv - Neuroscience 2024Quote: 120 000 iPS cells were plated on 12-well plates one day before the transduction by lentiviruses pLV_TRET_hNgn2_UBC_Puro (Addgene: 61474) and pLV_hEF1a-rtTA3 (Addgene:61472 ...
-
bioRxiv - Genetics 2024Quote: To generate B16F10 cells with a H2B-mCherry reporter the H2B mCherry reporter plasmid (Addgene Plasmid # 20972) was co-transfected with packaging plasmids PAX2 and pMD2.G into HEK293T ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were co-transfected with plasmids encoding a mixture of viral packaging proteins VSV-G (12259, Addgene), viral backbone psPAX2 plasimd (12260 ...
-
bioRxiv - Bioengineering 2023Quote: ... The amplified gRNA plasmid DNA was co-transfected into HEK 293T cells with psPAX2 (Addgene, plasmid #12260) and pMD2.G (Addgene ...
-
bioRxiv - Immunology 2023Quote: ... lentiCRISPR (with sgRNA cloned) was co-transfected into HEK293T cells with the packaging plasmids pVSVg (AddGene 8454) and psPAX2 (AddGene 12260) ...
-
bioRxiv - Cell Biology 2023Quote: ... Retroviruses were produced by transfecting HEK 293FT cells with a pBABE-puro-mCherry-EGFP-LC3B plasmid (Addgene, 22418 ...
-
bioRxiv - Microbiology 2023Quote: ... along with a luciferase gene with SARS-CoV-2 packaging sequence PS9 into 293T cells (Addgene 177942). Plasmids were gifts from Jennifer Doudna ...
-
bioRxiv - Developmental Biology 2023Quote: ... TCMC-OGFP cell line was generated by nucleofecting 1µg supercoiled Oct4-IRES-eGFP-PGK-Neo (Addgene #48681) plasmid to 1 million TCMC using P3 primary cell 4D-Nucelofector X kit (Lonza) ...
-
bioRxiv - Genomics 2023Quote: ... K562 CRISPRi and RPE1 CRISPRi cells expressing dCas9-BFP-KRAB (pHR-SFFV-dCas9-BFP-KRAB; Addgene, 46911) were described previously.136 Lenti-X 293T cells were purchased from Takara (#632180) ...
-
bioRxiv - Cell Biology 2023Quote: HeLa cells expressing DDX21-HA or OMP25-eGFP (expressed using pMXs-3XHA-EGFP-OMP25, Addgene: plasmid #83356) were cultured in 1x DMEM based media (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... HEK293FT cells were co-transfected with the Tet-on ssRFP-GFP-KDEL plasmid (Addgene 128257, Noboru Mizushima) and the lentivirus packaging plasmids psPAX2 (Addgene 12260 ...
-
bioRxiv - Molecular Biology 2023Quote: Cells were plated in 10-cm plates and transfected with plasmids expressing His6-SUMO1 (Addgene plasmid # 133770) or His6-SUMO2 (Addgene plasmid # 133771) ...
-
bioRxiv - Molecular Biology 2023Quote: ... the cells were co-transfected with 250ng of 3X ERE with TATA-box luciferase plasmid (Addgene 11354), a gift from Donald McDonnell ...
-
bioRxiv - Genomics 2023Quote: ... Control cells were co-transfected with pcDNA3.1-IRES-GFP28 (Addgene plasmid # 51406; http://n2t.net/addgene:51406; RRID:Addgene_51406) and the mCherry reporter construct above ...
-
bioRxiv - Microbiology 2023Quote: Lentiviral particles for transduction were generated from 293T cells transfected with psPAX2 (Didier Trono, Addgene plasmid # 12260) and pMD.2 (Didier Trono ...
-
bioRxiv - Cell Biology 2023Quote: Calu-1ERN1-/-cells were constructed by transfection with pSpCas9n(BB)-2A-Puro (Feng Zhang lab, Addgene #48139) containing sequences for guides targeting the start codon (WGE ID’s 1150311103 and 1150311093) ...
-
bioRxiv - Cell Biology 2023Quote: ... Virus was generated in HEK293T cells by transfection with the aforementioned transfer vectors and pMDLg (Addgene 12251), pRSV-REV (Addgene 12253) ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293T cells were used to produce lentivirus encoding Cas9 (lentiCas9-Blast, Addgene #52962, gift from Feng Zhang). BJAB ERAAP-dsRed cells were seeded at 1X10^6 cells/well in a 12-well plate and spin-infected with Cas9 expressing lentivirus in presence of 4ug/mL polybrene (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2023Quote: ... Lentiviruses were produced by co-transfection of HEK 293T cells with the packaging vector psPAX2 (Addgene #12260), the envelope expression plasmid pMD2.G (Addgene #12259 ...
-
bioRxiv - Cancer Biology 2023Quote: ... the cells were transfected with Lipofectamine 3000 and 2.5 μg of the plasmid pCMV CEPIA2mt (Addgene, 58218). Cells were imaged 48 hr after transfection ...
-
bioRxiv - Immunology 2023Quote: ... BRAFV600E PTEN-/- melanoma cells were transduced with lentivirus containing the pSCAR-Cas9-blast-GFP vector (Addgene: #162074). This system ...
-
bioRxiv - Cancer Biology 2023Quote: ... the indicated Cas9-expressing cell lines were transduced with a lentiviral LRG2.1 (U6-sgRNA-GFP, Addgene, #108098) sgRNA vector that co-expresses a GFP reporter ...
-
bioRxiv - Cell Biology 2023Quote: ... The PCR cassette was transfected into HeLa cells with a helper plasmid containing AsCas12a endonuclease (Addgene 89353). Following cleavage ...
-
bioRxiv - Microbiology 2024Quote: ... A549 cells stably expressing ACE2 (A549-ACE2) were generated by transducing with ACE2-encoding (generated using Addgene plasmid no ...
-
bioRxiv - Cell Biology 2024Quote: ... To generate Scribble and Dlg1 CRISPR/Cas9 KO cell lines we used pLentiCRISPR v2-Blast (Addgene 83480). DH-PH and VSV-G-DH-PH Rescue constructs were cloned using gateway recombination (Thermo Fisher ...
-
bioRxiv - Cell Biology 2024Quote: ... Next day cells were transiently transfected with the following plasmids: pcDNA3/hArf6(WT)-mCherry (Addgene plasmid #79422) and pcDNA3/hArf6(Q67L)-HA (Addgene plasmid # 79425 ...
-
bioRxiv - Systems Biology 2024Quote: We established a stable Cas9-expressing line by infecting EpiSC-5 cells with lentiCas9- Blast (Addgene 52962), followed by selection with 5 µg/ml blasticidin (Sigma 15205 ...
-
Safe plant Hsp90 adjuvants elicit an effective immune response against SARS-CoV2 derived RBD antigenbioRxiv - Molecular Biology 2023Quote: ... were prepared by co-transfecting HEK293T cells with psPAX2 (a gift from Didier Trono (Addgene plasmid # 12260) and pLentipuro3/TO/V5-GW/EGFP-Firefly Luciferase (a gift from Ethan Abel (Addgene plasmid # 119816) ...
-
bioRxiv - Microbiology 2023Quote: HeLa S3 cells were transduced with a Streptococcus pyogenes (sp)Cas9 expressing lentivirus (#52962; Addgene, Watertown, MA) at an MOI of 20 transduction units (TU)/cell ...
-
bioRxiv - Cancer Biology 2023Quote: Lentivirus was produced by transfection of 293T cells with the second-generation packaging system psPAX2 (#12260, Addgene) and pMD2.G (#12259 ...
-
bioRxiv - Immunology 2023Quote: Mouse naïve CD4+ T cells were transfected with C1-MPAct-mCherry (Addgene #155222, gift from Tobias Meyer) and C1-eGFP-CaaX (Addgene #86056 ...
-
bioRxiv - Cell Biology 2023Quote: ... Lentivirus were also generated co-transfecting HEK293T cells with the pCW57-CMV-ssRFP-GFP-KDEL (Addgene #128257) vector together withpPAX2 packaging plasmid and pMD2.G envelope plasmid.
-
bioRxiv - Cell Biology 2024Quote: ... 5 million HeLa cells were resuspended in 400 μL DMEM with 2 μg SpCas9 plasmid (Addgene, 71814), 500 ng gRNA plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... For co-transfection of NT-3 cells with siRNAs and RINS1 plasmid (gift from Dmytro Yushchenko, Addgene plasmid # 107290 ...
-
bioRxiv - Cancer Biology 2024Quote: Lenti-sgRNA/Cre vectors were individually co-transfected into 293T cells with pCMV-VSV-G (Addgene #8454) envelope plasmid and pCMV-dR8.2 dvpr (Addgene #8455 ...
-
bioRxiv - Molecular Biology 2024Quote: ... HEK-293T cells were transduced with LentiCRISPR_V2 vectors (Addgene plasmid 52961; http://n2t.net/addgene:52961; RRID: Addgene_52961) encoding the indicated sgRNA sequences ...
-
bioRxiv - Microbiology 2024Quote: CMT-93 cells expressing mCherry were created by transfection with pMCB320 (a gift from Michael Bassik, Addgene plasmid #89359 ...
-
bioRxiv - Developmental Biology 2021Quote: ... RD cells were transfected with the all-in-one Cas9/gRNA plasmid pSpCas9 BB-2A-GFP (PX458; Addgene; gRNA target sequence ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293 cells were transfected with 4µg shRNA p53-puromycin (Fachinetti Lab) + 4µg pMD2.G (12259 from Addgene, RRID:Addgene_12259) + 4µg psPAX2 (12260 from Addgene ...