Labshake search
Citations for Addgene :
1701 - 1750 of 2662 citations for Recombinant Human Epithelial Cell Adhesion Molecule His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: All constructs were cotransfected into HEK293T cells with lentiviral packaging vectors psPAX (Addgene cat#12260) and pMD2.g (Addgene cat#12259 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Stable cell lines were generated with the lentiviral Cas9-blasticidin vector (CRISPR knockout, Addgene, #125592), dCas9-KRAB-blasticidin (CRISPR interference ...
-
bioRxiv - Cell Biology 2023Quote: ... The cells were cotransfected with pCMV-AcGFP1-ORP9-PH and pCHRM1-Tango (Addgene plasmid #66248)70 using PEI-Max at a 1:1 ratio (each 0.5 µg) ...
-
bioRxiv - Cell Biology 2023Quote: ... Lentivirus was produced in HEK293T cells transfected with pMD2.G (Gift from Didier Trono, Addgene plasmid # 12259 containing the VSV-G envelope protein) ...
-
bioRxiv - Biochemistry 2023Quote: ... coli BL21 (DE3) cells using the plasmid pRSFDuet-1/CylLL/CylM-2 (Addgene ID #208759), following the method previously reported.9 For the preparation of lanthionine standard ...
-
bioRxiv - Biophysics 2023Quote: ... HEK293T cells were transfected with transfer plasmid and two helper plasmids psPAX2 (Addgene plasmid #12260) and VSV-G envelope expressing plasmid (pMD2.G ...
-
bioRxiv - Cell Biology 2023Quote: ... The cells were co-transfected with 2 μg lentivirus packaging plasmids (pMD2.G (Addgene #12259) and 10 μg psPAX2 (Addgene #12260) ...
-
bioRxiv - Cancer Biology 2024Quote: ... tIMEC-A-H1 cell line was generated by stable nucleofection of ppyCAG_RNaseH1_WT plasmid (Addgene, 111906)16 using the P1 Primary Cell 4D-Nucleofector X kit (Lonza ...
-
bioRxiv - Molecular Biology 2023Quote: The GBP1-GFP HeLa cell line was constructed using the LentiCRISPR V2-Blast (Addgene #83480) vector containing Cas9 sequence and a gRNA targeting exon 11 of the GBP1 gene that encodes the stop codon (See Table S1 for gRNA sequence) ...
-
bioRxiv - Cell Biology 2024Quote: ... HEK293T cells were transfected with the DNA of lentiviral packaging plasmids vSVG (Addgene, USA, #8454), RSV (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... HEK293T cells were transfected with the DNA of lentiviral packaging plasmids vSVG (Addgene, USA, #8454), RSV (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were transfected with the pCAG-eSpCas9-2A-GFP (generous gift from Jizhong Zou, Addgene plasmid #79145 ...
-
bioRxiv - Neuroscience 2024Quote: ... at a 1:40 dilution for sparse cell targeting and AAV8-hSyn-dio-GFP (Addgene #50457-AAV8 ...
-
bioRxiv - Cancer Biology 2024Quote: Stable cell lines were generated by retroviral infection with pBABE-puro (1764, Addgene, Cambridge, MA), pBABE-zeo (1766 ...
-
bioRxiv - Cell Biology 2024Quote: ... B16-F1 cells were transiently transfected with LifeAct-TagRed and PA-GFP-Actin (Addgene #57121) as described above ...
-
bioRxiv - Cancer Biology 2024Quote: 1099 or pB3 cell line derivatives expressing pCDH-EF1-Luc2-P2A-tdTomato (Plasmid #72486, Addgene) were resuspended at a concentration of 1×106/mL in culture medium ...
-
bioRxiv - Cancer Biology 2024Quote: ... Therefore, we used lipofection (Lipofectamine 3000, #L3000001) of HEK293T cells to package psPAX2 (Addgene, #12260), pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... AICSDP-42:AAVS1-mTagRFPT-CAAX was a gift from Allen Institute for Cell Science (Addgene plasmid # 107580 ...
-
bioRxiv - Cell Biology 2020Quote: hES cells (H1) were thawed at P29 and transfected with 3.3µM of each hCas9D10A (Addgene #74495), and a gRNA/donor plasmid (pUC_lmnA_Neo_exn1_donor_fixed containing gRNA sequence GCAGGAGCTCAATGATCGCTTGG ...
-
bioRxiv - Immunology 2021Quote: ... TOP10 competent cells were used for all subsequent plasmids except lentiCRISPR v2 (Addgene plasmid no. 52961)43 ...
-
bioRxiv - Cell Biology 2020Quote: ... we transiently transfected MCF7 and SMMC-7721 cells with the Utrophin-GFP reporter (Plasmid #26737, Addgene) using X-tremeGENE HP DNA Ttransfection Reagent (Roche) ...
-
bioRxiv - Molecular Biology 2020Quote: HeLa cells were infected with lentivirus carrying the Cas9-BFP (blue fluorescent protein) vector (Addgene 52962). HCT116 and HEK293T were transfected with the same vector using Lipofectamine 2000 (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: ... HEK293/HEK293T cells stably transduced with the Wnt reporter Super TOP-Flash (STF, Addgene Plasmid #12456) were previously described (Bauer et al ...
-
bioRxiv - Biochemistry 2022Quote: ... these cells were transduced with lentiviral particles for TetO-Fuw empty vector (Addgene plasmid number 85747)(30) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 6cm dishes of cells were transfected with 1ug of guide RNA expressing px300 plasmid (#42230, Addgene) and 1ug of each HDR template/NHEJ PCR product ...
-
bioRxiv - Molecular Biology 2020Quote: ... TbC1 cells were reverse transfected with 400ng of U6>sgRNA plasmids (George Church, Addgene plasmid #41824) according to Table S2 and 3μL Lipofectamin 2000 (Life Technologies) ...
-
bioRxiv - Cell Biology 2022Quote: ... and TAX1BP1 KO HeLa cells were cotransfected with the DNA fragment and the PX459 (Addgene #48139)-based plasmid expressing Cas9 and gRNA (GGGGCCACTAGGGACAGGAT) ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transduced by thermosensitive retroviral gene transfer of SV40 T antigen (LOX-CW-CRE, Addgene) at a MOI of 5 in Proliferation UREC medium with 8μg/mL polybrene (64) ...
-
bioRxiv - Genomics 2020Quote: ... Cells were transfected with 0.5 ug gRNA gblock and 2.5 ug px458 plasmid (Addgene plasmid # 48138) containing spCas9 and GFP ...
-
bioRxiv - Cancer Biology 2020Quote: Cas9-expressing p185+ B-ALL cells were transduced with the Brie CRISPR KO library (Addgene #73633) at a multiplicity of infection of 0.5 with an sgRNA coverage of 400x (24) ...
-
bioRxiv - Biophysics 2019Quote: ... both proteins were expressed in HEK293T cells using a modified pTT5 expression vector (Addgene no. 44006), purified using StrepTactin beads (GE ...
-
bioRxiv - Neuroscience 2019Quote: ... L cells were transiently transfected with Pi16-tGFP (Origne MG219996) and pm-Turq-ER (Addgene 36204) with Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Immunology 2019Quote: ... cells were transduced with a lentiviral dCas9-HA-BFP-KRAB-NLS expression vector (Addgene plasmid #102244).
-
bioRxiv - Cancer Biology 2019Quote: ... Then cells were transfected with 100 ng of pTsgRNA-DMP-Cas9-EGFP or pEGFP-C1 (Addgene) using Lipofectamine® 2000 Reagent (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: V6.5 cells were infected with lentiviruses harboring the pHR-SFFV-dCas9-BFP-KRAB vector (Addgene,46911) in which the SFFV promoter was replaced with an Ef1a promoter ...
-
bioRxiv - Molecular Biology 2019Quote: ... K562 cells were transduced with Tet-pLKO-neo (a gift from Dmitri Wiederschain, Addgene plasmid #21916) containing either LSD1- ...
-
bioRxiv - Genomics 2019Quote: Lentiviral vectors were produced by transfection of HEK 293T cells with the envelope (psPAX2, Addgene #12260), packaging (pMD2.G ...
-
bioRxiv - Genomics 2019Quote: ... or NIH3T3 cells transiently transfected with Denr cloned into a FLAG-Venus-pLenti6 vector (Addgene 36948). Cells were grown to confluency in a 15-cm dish ...
-
bioRxiv - Genetics 2021Quote: ... HEK293T cells were transfected using calcium phosphate with psPAX2 (gift from Didier Trono, Addgene No.12260), pCAG-Eco (gift from Arthur Nienhuis and Patrick Salmon ...
-
bioRxiv - Bioengineering 2020Quote: U2OS cells were cultured and transfected with 100-200 ng of mEmerald-Tomm20 plasmid (Addgene, 54281) directly on the BIO-133 bottomed well plate ...
-
bioRxiv - Bioengineering 2021Quote: CRISPR knockdown cells were generated using the lentiCRISPRv2 system (gift of F. Zheng, Addgene plasmid #52961). Scramble guideRNA (gRNA ...
-
bioRxiv - Cancer Biology 2021Quote: Cell lines stably expressing Cas9 were generated by lentiviral infection with pCRISPRV2-FLAG-CAS9 (Addgene #52961) followed by puromycin selection and monoclonal population generation by limiting dilution in 96 well plates ...
-
bioRxiv - Biophysics 2021Quote: ... cells were transfected with transgene plasmid together with lentivirus packaging plasmids psPAX2 (Addgene, Cat. No. 12260) and pMD2.G (AddGene ...
-
bioRxiv - Cancer Biology 2020Quote: ... We enriched RM1-BoM1 cells negative for GFP and transduced with Tdtomato (LeGO-T2, Addgene #27342) and luciferase (pENTR-LUC ...
-
bioRxiv - Microbiology 2020Quote: Huh7.5.1 cells were stably transduced with lentivirus from lentiCas9-Blast (Addgene #52962, gift from Feng Zhang) and subsequently selected using blasticidin ...
-
ORAI1 establishes resistance to SARS-CoV-2 infection by regulating tonic type I interferon signalingbioRxiv - Microbiology 2021Quote: ... HEK293T cells were transfected with plasmid encoding ACE2 and packaging vectors (pMD2.G and psPAX2, Addgene) using calcium phosphate transfection method ...
-
bioRxiv - Molecular Biology 2021Quote: ... Viral particles were generated by transfecting HEK293T cells with the packaging plasmids pMD2.G (Addgene 12259) and psPAX2 (Addgene 12260 ...
-
bioRxiv - Cancer Biology 2020Quote: HeLa cells were infected with lentivirus carrying the Cas9-BFP (blue fluorescent protein) vector (Addgene 52962). HCT116 were transfected with the same vector using Lipofectamine 2000 (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293T cells were transfected with the pLenti-PGK-Tacc3 or pLKO.1 TRC (control, Addgene 10879), pMD2G (Addgene 12259 ...
-
bioRxiv - Biophysics 2020Quote: ... we stably integrated tdMCP-tdGFP and OsTIR1 into cells using a standard lentiviral production protocol (Addgene). For lentivirus production ...