Labshake search
Citations for Addgene :
1801 - 1850 of 10000+ citations for Rat FAM24A shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... and the other two were cloned using the same plasmid and plasmids acquired from Addgene. Using the orx.GCaMP6s virus ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the T7RNAPK276R sequence was PCR amplified from plasmid pRS315-nls-T7-RNAP (Addgene plasmid #33152) (30 ...
-
bioRxiv - Cell Biology 2019Quote: HeLa cells were co-transfected with plasmid encoding mCherry-tagged Parkin (31) (Addgene plasmid #23956;) and encoding either ABCB-ChR2-YFP or ABCB-YFP using the Neon Transfection System (Invitrogen ...
-
bioRxiv - Biophysics 2019Quote: ... the mScarlet-I gene was obtained from the Lck-mScarlet-I plasmid (Addgene, plasmid #98821), and the mCherry gene was obtained from the pmCherry-N1 plasmid (Takara Bio) ...
-
bioRxiv - Microbiology 2019Quote: ... The Cas9-eGFP expression plasmid (pMJ920) was a gift from Jennifer Doudna (Addgene plasmid # 42234) (51) ...
-
bioRxiv - Cancer Biology 2019Quote: ... The pCMV5-ALK2-WT plasmid was a generous gift from Jeff Wrana (Addgene plasmid #11741). All experiments were performed using post-natal day 1 (P1 ...
-
bioRxiv - Molecular Biology 2019Quote: pcDNA3.1(+) CircRNA Mini Vector (plasmid number 60648) [19] and pcDNA3.1 plasmids both obtained from Addgene plasmid repository were used for expressing NFATc3 in cancer cells ...
-
bioRxiv - Plant Biology 2019Quote: ... placing fluorescent protein expression under the control of the cauliflower mosaic virus 35S promoter (plasmids pN_35S/mEGFP and pN_35S/mApple available at www.addgene.org as plasmids #132565 (RRID:Addgene_132565) and #132566 (RRID:Addgene_132566) ...
-
bioRxiv - Cell Biology 2020Quote: ... and ligated into digested pspCas9(BB)-2A-puro plasmid (plasmid no. 62988, Addgene, Cambridge, MA). HEK293 cells were suspended in 2 ml of DMEM supplemented with 10% FBS and plated in 6-well plates ...
-
bioRxiv - Bioengineering 2021Quote: ... plasmids were co-transfected with pCMV-VSVG (a gift from Bob Weinberg, Addgene plasmid #8454), pMDLg/pRRE ...
-
bioRxiv - Biochemistry 2020Quote: ... pJSC173 were gifts from Jennifer Doudna and/or Keith Joung (Addgene plasmid # 39312; http://n2t.net/addgene:39312; RRID:Addgene_39312; Addgene plasmid # 101209; http://n2t.net/addgene:101209; RRID:Addgene_101209 ...
-
Enzymatic RNA Biotinylation for Affinity Purification and Identification of RNA-protein InteractionsbioRxiv - Biochemistry 2020Quote: A plasmid encoding obligate dimeric TGT was cloned from the TGT-His plasmid (Addgene #138201) using DNA HiFi Assembly (New England Biolabs ...
-
bioRxiv - Cancer Biology 2020Quote: ... together with the packaging plasmid psPAX2 (a gift from Dr. D. Trono, Addgene plasmid #12260), and pCMV-VSV-G-RSV-Rev (a gift of Dr ...
-
bioRxiv - Neuroscience 2020Quote: ... with 3 µg of the episomal plasmid mix (equimolar mixture of plasmids obtained from Addgene: pCE-hOct3/4 ...
-
bioRxiv - Bioengineering 2021Quote: ... Plasmids expressing pegRNAs were constructed by Gibson assembly using BsaI-digested acceptor plasmid (Addgene #132777) as the vector.
-
bioRxiv - Neuroscience 2019Quote: ... with packing plasmid psPAX2 and envelope coding plasmid pMD2.G (Addgene#12260 and #12259, respectively) using the calcium phosphate method ...
-
bioRxiv - Biochemistry 2021Quote: ... coli cells using pET21a plasmid (a gift from Michael J Fox Foundation, Addgene plasmid # 51486) and was purified at 4 ℃ as previously described.29 Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... The AP1 luciferase reporter plasmid was a gift from Alexander Dent (Addgene plasmid #40342; 3XAP1pGL3), the NF-κB luciferase reporter was purchased from Promega (#E8491 ...
-
bioRxiv - Cell Biology 2021Quote: ... and pAAV-hSyn-DIO-hM3D(Gq)-mCherry (Plasmid #44361) plasmids were also purchased from Addgene.
-
bioRxiv - Neuroscience 2020Quote: We have described several of the plasmids previously: pAAV-cFos-tTA-pA (Addgene plasmid #66794)57 ...
-
bioRxiv - Plant Biology 2021Quote: ... The gene coding for zeocin resistance was inserted into the plasmid pKSdiaCaS10_sgRNA (Addgene, plasmid #74923) by Gibson cloning (Gibson et al. ...
-
bioRxiv - Biophysics 2020Quote: The plasmid containing aS gene was a kind of gift from HilalLashuel (Addgene plasmid # 36046)67 ...
-
bioRxiv - Biophysics 2020Quote: ... [37] and the pLenti.PGK.Lifeact-GFP.W plasmid was a gift from Rusty Lansford (Addgene plasmid #51010). Following lentiviral infection and a period of culture to expand the population ...
-
bioRxiv - Cancer Biology 2021Quote: ... The pCDNA3.1-V5-PTK2B (PYK2) plasmid was a gift from Kai Johnsson (Addgene plasmid # 127233). The siRNAs were ...
-
bioRxiv - Developmental Biology 2022Quote: E.coli strain BL21-DE3 was transformed with plasmid DNA pAG-MNase-6xHis (Addgene, plasmid #123461). Recombinant pAG-MNase was purified from cells grown in LB medium to OD600 0.6 at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... H37Rv Mtb was transformed with the episomal RecT recombinase-expressing plasmid pKM402 (Addgene plasmid # 107770) and was selected on 7H10 agar containing kanamycin (20 µg/mL) ...
-
bioRxiv - Developmental Biology 2022Quote: ... DSCP was subcloned from the pBPGUw plasmid (Addgene plasmid #17575; http://n2t.net/addgene:17575; RRID:Addgene_17575)(Pfeiffer et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... CRISPR lentiviral plasmid and lentiviral packaging plasmids (pMDLg/pRRE, pRSV-Rev, and pMD2.G; Addgene) were transfected into 293T cells ...
-
bioRxiv - Cell Biology 2022Quote: ... were transformed with a plasmid encoding the GST-tagged domain of Rhotekin (Addgene plasmid # 15247). Cells were cultivated in Terrific broth (TB ...
-
bioRxiv - Cancer Biology 2022Quote: ... 293T cells were co-transfected with pBABE-puro-SV40-LT target plasmid (Addgene, Plasmid #13970) together with psPAX2 (Addgene ...
-
bioRxiv - Neuroscience 2020Quote: ... and the helper plasmids pMDLg/pRRE (Addgene plasmid # 12251; http://n2t.net/addgene: 12251; RRID: Addgene_12251), pRSV-Rev (Addgene plasmid # 12253 ...
-
bioRxiv - Cell Biology 2019Quote: ... A plasmid containing a mTurquoise2-H2A sequence (a gift from Dorus Gadella, Addgene plasmid #36207)39 was PCR amplified to append BamHI and NotI restriction sites (Forward ...
-
bioRxiv - Molecular Biology 2021Quote: ... was generated from a modified version of the pgk-ATG-frt plasmid (Addgene plasmid #20734), in which the region of pgk-ATG-frt comprised between the EcoRI site and the PciI site was substituted with the rabbit β-globin polyadenylation signal (RBG pA) ...
-
bioRxiv - Neuroscience 2021Quote: ... Feng Zhang (Addgene plasmid # 89308 ; http://n2t.net/addgene:89308 ; RRID:Addgene_89308, Addgene plasmid # 61425 ; http://n2t.net/addgene:61425 ;RRID:Addgene_61425 ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by insertion into mCherry2-N1 plasmid (kind gift from Michael Davidson, Addgene plasmid # 54517) using EcoRI and XhoI restriction sites ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by insertion into mEGFP-C1 plasmid (kind gift from Michael Davidson, Addgene plasmid # 54759) using EcoRI and KpnI restriction sites ...
-
bioRxiv - Neuroscience 2021Quote: ... titre 2.4 × 1012) was made using an AAV-retro helper plasmid (Addgene plasmid ID 81070) as described previously(McClure et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... The plasmid vector pOPINE GFP nanobody was a gift from Brett Collins (Addgene plasmid # 49172) (Kubala et al ...
-
bioRxiv - Developmental Biology 2022Quote: ... The pCAG-dGBP1-TagBFP plasmid was a gift from Connie Cepko [49] (Addgene plasmid #80086). Calreticulin overexpression constructs were generated by PCR amplification off of genomic DNA ...
-
bioRxiv - Physiology 2022Quote: ... pSF-lenti or pLKO.1 together with the two helper plasmids psPAX2 (Addgene plasmid 12260) and pMD2.G (Addgene plasmid 12259 ...
-
bioRxiv - Cell Biology 2020Quote: ... or a fluorescent protein (pCDNA3-GFP; Addgene plasmid #74165 or mCherry2-N1; Addgene plasmid #54517) was used to transfect HEK-293 cells at 70-90% confluency using Lipofectamine 3000 reagent (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2020Quote: ... We isolated DNA for the HIV gag gene from the pLAIΔmls plasmid (Addgene, plasmid #24594) and cloned the isolated DNA into a pGEM-TEasy plasmid vector (Promega ...
-
bioRxiv - Molecular Biology 2020Quote: ... Smad3 overexpression plasmid was constructed by subcloning human Smad3 cDNA into pcDNA3.0 backbone plasmid (Addgene). GAS5 adenoviral vector was constructed by inserting mouse GAS5 cDNA into pShuttle-IRES-hrGFP-1 vector (Agilent) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... A PAR2 specific guide (CCCCAGCAGCCACGCCGCGC) was cloned into the lentiCRISPR v2 plasmid (Addgene plasmid # 52961). 48 hours after transfection ...
-
bioRxiv - Neuroscience 2020Quote: ... and were cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid (Addgene plasmid 62988) according to a previously described protocol (Ran et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... subconfluent HEK293T cells with the library plasmid pool together with packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Genetics 2019Quote: ... Plasmid pHsp70-Cas940 (provided by Melissa Harrison & Kate O’Connor-Giles & Jill Wildonger, Addgene plasmid #45945) was included as a source of Cas9 and plasmid EGDhg2t was included as a source of gRNA in the injection ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... the tight TRE promoter was amplified from the Puro-Cas9 donor plasmid (Addgene plasmid #58409) with primers TRE_F &R and inserted into the EcoRV restriction site of AAVS1-Neo-M2rtTA (a gift from Dr Rudolf Jaenisch ...
-
bioRxiv - Developmental Biology 2021Quote: ... These two sites were cloned into the plasmid pCFD4-U6:1_U6:3tandemgRNAs (Addgene plasmid #49411). The plasmid was injected into y2cho2v1 ...
-
bioRxiv - Cell Biology 2020Quote: ... double digested and ligated into EcoRI/SalI double digested pET-GFP plasmid (Addgene, Plasmid # 29663) to form pET-GFP-SRB-2 ...