Labshake search
Citations for Addgene :
1701 - 1750 of 10000+ citations for Rat FAM24A shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... pMD2.G (Addgene plasmid 12259), pMDLg/pRRE (Addgene plasmid 12251) ...
-
bioRxiv - Molecular Biology 2023Quote: ... pMDLg/pRRE (Addgene plasmid 12251), pRSV-Rev (Addgene plasmid 12253) ...
-
bioRxiv - Cell Biology 2022Quote: ... Bruce Conklin (73497, Addgene plasmid). The gRNA sequence for targeting the AAVS1 locus (sgRNA-T2 ...
-
bioRxiv - Bioengineering 2023Quote: ... OA-1085L (Addgene plasmid #191376), and OA-1093B (Addgene plasmid #194003) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and HR_pGK_LaG17_synNotch_Gal4VP64 (Addgene plasmid# 79127). The response-element plasmids pHR_TRE_MyoD-P2A-mCherry ...
-
bioRxiv - Microbiology 2023Quote: ... The pHnCBS1D plasmid (Addgene, UK) was used as the template for amplification of native csoS2 ...
-
bioRxiv - Microbiology 2023Quote: ... The plasmid pBA559 (Addgene 186235), encoding the LbuCas13a gene under the TetR inducible promoter37 ...
-
bioRxiv - Cancer Biology 2023Quote: ... pMDLg/pRRE (Addgene Plasmid #12251) & pMD2.G (Plasmid #12259 ...
-
bioRxiv - Genetics 2023Quote: ... All plasmids came from Addgene and were ordered by sinozhongyuan (Beijing ...
-
bioRxiv - Molecular Biology 2023Quote: ... dCas9-VP64 (Addgene, plasmid #61425) lentiviral transduction was performed in the presence of hexadimethrine bromide (final concentration 8 g/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids were obtained from Addgene as follows ...
-
bioRxiv - Cell Biology 2023Quote: ... Myo10-GFP (Addgene Plasmid#135403) was previously described89.
-
bioRxiv - Immunology 2023Quote: ... LentiCRISPRv2-mCherry (Addgene, Plasmid #99154), LentiCRISPRv2-BFP ...
-
bioRxiv - Microbiology 2023Quote: ... David Sabatini (Addgene plasmid # 1864). 8 hr post-transfection ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Plasmid pJL1-sfGFP (Addgene #102634) was used as a control for CFPS activity ...
-
bioRxiv - Immunology 2023Quote: ... IgG3 (Addgene plasmid #61885; RRID:Addgene_61885), and IgG4 (Addgene plasmid #61887 ...
-
bioRxiv - Cell Biology 2023Quote: ... pMDLg/pRRE (Addgene plasmid #12251), and pMD2.G (Addgene plasmid #12259).
-
bioRxiv - Cell Biology 2023Quote: ... The plasmids purchase from Addgene what listed in Supplementary Table S4 ...
-
bioRxiv - Genetics 2023Quote: ... Plasmids were obtained from Addgene. Candidates were selected using the dominant Roller phenotype and hygromycin resistance ...
-
bioRxiv - Cell Biology 2023Quote: pBABE-Puro (Addgene, Plasmid #1764), pBABE-Puro-EGFP (Addgene ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Geir Mathiesen (Addgene plasmid # 122030). E ...
-
bioRxiv - Neuroscience 2023Quote: ... pMD2.G (Addgene Plasmid #12259). Plasmids were diluted in DMEM ...
-
bioRxiv - Cell Biology 2023Quote: ... psPAX2 (Plasmid: no. 12260; Addgene), and pCMV-VSV-G-RSV-Rev (RIKEN BioResource Center ...
-
bioRxiv - Immunology 2023Quote: ... IgG3 (Addgene plasmid #61885; RRID:Addgene_61885), and IgG4 (Addgene plasmid #61887 ...
-
bioRxiv - Cell Biology 2023Quote: ... (Addgene plasmid # 128257; RRID: Addgene_128257). pLenti CMV GFP Hygro (656-4 ...
-
bioRxiv - Neuroscience 2023Quote: ... Connie Cepko (Addgene plasmid #13776). The retroviral pMSCVhyg plasmid expressing wild type (WT ...
-
bioRxiv - Genomics 2023Quote: ... The DR274 plasmid (Addgene # 42250) was used as a template for PCR using a universal primer (AAAAGCACCGACTCGGTGCCACT ...
-
bioRxiv - Genetics 2023Quote: ... and psPAX2 (Addgene plasmid #12260) lentiviral packaging plasmids ...
-
bioRxiv - Molecular Biology 2023Quote: ... William Sellers (Addgene plasmid # 10792). MATR3 WT and the single domain deletion constructs were gifts from Dr ...
-
bioRxiv - Cell Biology 2023Quote: ... or pCoPuro (Addgene plasmid #17533) and selecting in the presence of 100 µg/ml Hygromycin B (Enzo Life Sciences ...
-
bioRxiv - Cancer Biology 2023Quote: ... NRF2 plasmid (##36971) from Addgene was transiently transfected into HEK293FT cells using Lipofectamine 2000 (#11668019 ...
-
bioRxiv - Cell Biology 2023Quote: pHIV-tdTomato (Addgene plasmid #21374) was constructed by Dr ...
-
bioRxiv - Cell Biology 2023Quote: ... pLAMP1-miRFP703 (Addgene plasmid #79998)66 from Dr ...
-
bioRxiv - Cell Biology 2023Quote: ... mEGFP-C1 (Addgene plasmid #54759) and mTagBFP2-Lifeact-7 (Addgene plasmid #54602)69 from Dr ...
-
bioRxiv - Cell Biology 2023Quote: ... pLAMP1-miRFP703 (Addgene plasmid #79998)66 (lysosome marker) ...
-
bioRxiv - Cell Biology 2023Quote: ... and Flag_HsIRE1a_pBabePuro (Addgene, Plasmid #54337) were purchased from Addgene (Watertown ...
-
bioRxiv - Microbiology 2023Quote: ... both obtained from Addgene (Addgene plasmids #103973 and #54531) 50,51 ...
-
bioRxiv - Cell Biology 2023Quote: ... (Addgene plasmid # 128257; RRID: Addgene_128257). pLenti CMV GFP Hygro (656-4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... sfGFP-N1 (Addgene plasmid #54737) plasmid was a gift from Geoffrey Waldo ...
-
bioRxiv - Cell Biology 2023Quote: ... and psPAX2 (Addgene plasmid # 12260) using X-tremeGENE 9 transfection reagent[22] ...
-
bioRxiv - Molecular Biology 2023Quote: ... in the pLIB plasmid (Addgene_80610) between BamHI and SalI sites.
-
bioRxiv - Genetics 2023Quote: ... and psPAX2 (Plasmid #12260, Addgene) plasmids in a mass ratio of 0.5/0.5/1.0 for a total of 2µg ...
-
bioRxiv - Bioengineering 2024Quote: ... mScarlet-EEA1 (Addgene plasmid # 169067) and GFP-Rab5B (Addgene plasmid # 61802 ...
-
bioRxiv - Cell Biology 2024Quote: GCaMP6s (Addgene plasmid #40753(53)) binds Ca2+ with peak emission at 510 nm when excited at 480 nm.(53 ...
-
bioRxiv - Genomics 2024Quote: The FUGW plasmid (Addgene #14883) was used for the generation of the L-cells expressing eGFP ...
-
bioRxiv - Cell Biology 2024Quote: ... with plasmids pCFJ210 (#30538 Addgene), pJA245 #21506 Addgene) ...
-
bioRxiv - Biophysics 2024Quote: ... plasmids are available from Addgene.
-
bioRxiv - Cancer Biology 2024Quote: ... Patrick Salmon (Addgene plasmid # 45956).
-
bioRxiv - Immunology 2024Quote: ... The pX335 plasmid (Addgene #42335) was used to generate a DNA template for sgRNA in vitro transcription ...
-
bioRxiv - Neuroscience 2024Quote: pCAG-mRFP (plasmid #32600, Addgene) was deposited by Anna-Katerina Hadjantonakis57 ...