Labshake search
Citations for Addgene :
1601 - 1650 of 10000+ citations for Rat FAM24A shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Spatial visualization of A-to-I Editing in cells using Endonuclease V Immunostaining Assay (EndoVIA)bioRxiv - Molecular Biology 2024Quote: ... or coilin-GFP plasmid (Addgene) using Opti-MEM Reduced Serum Medium (Gibco ...
-
bioRxiv - Neuroscience 2024Quote: ... pBiFC-VC155 (Addgene plasmid # 22011) [54] and pBiFC-VN155 (I152L ...
-
bioRxiv - Neuroscience 2023Quote: ... and packaging plasmids (psPAX2; Addgene) using a previously described protocol99 ...
-
bioRxiv - Neuroscience 2024Quote: ... pcDNA-SADB19P (Addgene plasmid # 32631), pcDNA-SADB19L (Addgene plasmid # 32632 ...
-
bioRxiv - Neuroscience 2024Quote: ... pcDNA-SADB19L (Addgene plasmid # 32632) and pcDNA-SADB19G (Addgene plasmid # 32633) ...
-
bioRxiv - Neuroscience 2024Quote: ... pcDNA-SADB19N (Addgene plasmid # 32630), pcDNA-SADB19P (Addgene plasmid # 32631) ...
-
bioRxiv - Genetics 2024Quote: ... pRSV-Rev (Addgene plasmid # 12253) and pMD2.G (Addgene plasmid # 12259 ...
-
bioRxiv - Genetics 2024Quote: ... pMDLg/pRRE (Addgene plasmid # 12251), pRSV-Rev (Addgene plasmid # 12253 ...
-
bioRxiv - Genetics 2024Quote: ... LentiCRISPRv2-mCherry (Addgene plasmid # 99154) was a gift from Agata Smogorzewska ...
-
bioRxiv - Genetics 2024Quote: ... while pRS418 (Addgene plasmid #11256) was used to amplify the clonNAT cassette and also was the vector of choice for Gibson assembly cloning methodology for the promoter/allele swap experiments.
-
bioRxiv - Developmental Biology 2024Quote: ... and pCFJ104 (Addgene Plasmid #19328) at 2.5 ng/µL and 5 ng/µL concentrations respectively ...
-
bioRxiv - Genetics 2023Quote: ... pLentiV_Blast (Addgene, plasmid no. 111887) was created by Christopher Vakoc (Tarumoto et al. ...
-
bioRxiv - Genetics 2023Quote: ... pLJM1 (Addgene; plasmid no. 91980) was created by Joshua Mendell (Golden et al. ...
-
bioRxiv - Cell Biology 2024Quote: pGFP-EB1 (Addgene plasmid #17234) was transiently transfected into the B16-F1 control and Cyri-b KO cells and imaged live on a Zeiss 880 microscope with Airyscan with a Plan-Apochromat 63x/1.4 oil DIC objective lens with the 488nm laser at 1 image per second for 120 seconds ...
-
bioRxiv - Developmental Biology 2024Quote: The plasmids psPax2 (Addgene; 12260) and pMD2.G (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... psPAX2 packaging plasmids (Addgene #12260), and pMD2.G plasmid expressing VSV-G (Addgene #12259 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Geir Mathiesen (Addgene plasmid # 122030). E ...
-
bioRxiv - Cell Biology 2023Quote: ... and Flag_HsIRE1a_pBabePuro (Addgene, Plasmid #54337) were purchased from Addgene (Watertown ...
-
bioRxiv - Cell Biology 2023Quote: ... or pCoPuro (Addgene plasmid #17533) and selecting in the presence of 100 µg/ml Hygromycin B (Enzo Life Sciences ...
-
bioRxiv - Cell Biology 2023Quote: pHIV-tdTomato (Addgene plasmid #21374) was constructed by Dr ...
-
bioRxiv - Genomics 2023Quote: ... The DR274 plasmid (Addgene # 42250) was used as a template for PCR using a universal primer (AAAAGCACCGACTCGGTGCCACT ...
-
bioRxiv - Genetics 2023Quote: ... and psPAX2 (Addgene plasmid #12260) lentiviral packaging plasmids ...
-
bioRxiv - Genetics 2023Quote: ... psPAX2 (Addgene, plasmid no. 12260) was created by Didier Trono) ...
-
bioRxiv - Microbiology 2024Quote: ... SIVSAB-92018Vpr (Addgene plasmid #115822), SIVAGM-MALVpr (Addgene plasmid #115828) ...
-
bioRxiv - Microbiology 2024Quote: ... SIVCPZ-LB7Vpr (Addgene plasmid #115834), SIVgorCP684conVpr (Addgene plasmid #115835) ...
-
bioRxiv - Microbiology 2024Quote: ... and SIVrcm02CM8081Vpr (Addgene plasmid #115838) were a gift from Jeremy Luban57 ...
-
bioRxiv - Microbiology 2024Quote: ... SIVAGM-MALVpr (Addgene plasmid #115828), SIVCPZ-TAN3Vpr (Addgene plasmid #115833) ...
-
bioRxiv - Microbiology 2024Quote: ... SIVCPZ-TAN3Vpr (Addgene plasmid #115833), SIVCPZ-LB7Vpr (Addgene plasmid #115834) ...
-
bioRxiv - Microbiology 2024Quote: ... Geoff Wahl (Addgene plasmid #11680) (45) ...
-
bioRxiv - Microbiology 2023Quote: ... pMDLg/pRRE (Addgene plasmid # 12251) and pRSV-Rev (Addgene plasmid # 12253 ...
-
bioRxiv - Microbiology 2023Quote: pMD2.G (Addgene plasmid # 12259), pMDLg/pRRE (Addgene plasmid # 12251 ...
-
bioRxiv - Cancer Biology 2023Quote: LentiCas9-Blast (Addgene plasmid #52962) and lentiGuide-Puro (Addgene plasmid #52963 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pBTK503 (Addgene plasmid No. 110616) and pBTK570 (Addgene plasmid No ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmids were ordered from Addgene and were cultured and isolated according to the company’s recommendations ...
-
bioRxiv - Cell Biology 2022Quote: ... Renilla luciferase control plasmid (Addgene plasmid 12179 ...
-
bioRxiv - Cell Biology 2023Quote: ... Didier Trono (Addgene plasmid #12260). Approximately 48 h following transfection ...
-
bioRxiv - Immunology 2023Quote: ... 10ug packaging plasmid psPAX2 (Addgene) and 5ug envelop plasmid pMD2.G (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... pPAGFP-C1 plasmid (Addgene #11910) was a gift from Svetlana Deryusheva (Carnegie Institution for Science ...
-
bioRxiv - Molecular Biology 2023Quote: ... GFP-RelA (Plasmid #23255, Addgene), and a Renilla luciferase control plasmid were prepared using the HiSpeed Plasmid Maxi kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2023Quote: pLX-sgRNA (Addgene plasmid # 50662) and pCW-Cas9 (Addgene plasmid # 50661 ...
-
bioRxiv - Molecular Biology 2023Quote: ... using pRS315 (Addgene Plasmid #3974) and screened by growing transformed yeast on SC dropout plates lacking leucine ...
-
bioRxiv - Cell Biology 2023Quote: ... the pGEX6P1-GFP plasmid (RRID:Addgene_61838) was transformed into BL21 (DE3 ...
-
bioRxiv - Microbiology 2023Quote: ... Didier Trono (plasmid #12260, Addgene). The pVSV-G expression construct is described elsewhere (91) ...
-
bioRxiv - Cell Biology 2023Quote: ... pUC57-GATA1 (Addgene plasmid 194436), and pUC57-b-globin (Addgene plasmid 194437 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and pVSV.G (Addgene Plasmid #12259) third generation lentiviral vectors were transiently transfected into HEK293T cells using polyethylenimine (PEI ...
-
bioRxiv - Microbiology 2023Quote: ... The plasmid pBA559 (Addgene 186235), encoding the LbuCas13a gene under the TetR inducible promoter37 ...
-
bioRxiv - Cancer Biology 2023Quote: ... pMDLg/pRRE (Addgene Plasmid #12251) & pMD2.G (Plasmid #12259 ...
-
bioRxiv - Genetics 2023Quote: ... All plasmids came from Addgene and were ordered by sinozhongyuan (Beijing ...
-
bioRxiv - Molecular Biology 2023Quote: ... GFP-2xSidM (Addgene plasmid #51472) in which GFP was exchanged with mCherry ...
-
bioRxiv - Cell Biology 2023Quote: ... Myo10-GFP (Addgene Plasmid#135403) was previously described89.