Labshake search
Citations for Addgene :
1901 - 1950 of 10000+ citations for Rat FAM24A shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... The retroviral Centrin2-GFP expression plasmid was kindly provided by YIain Cheeseman (Addgene plasmid, 69745), while the retroviral Nek2 plasmid was acquired from DNASU (Backbone ...
-
bioRxiv - Cell Biology 2023Quote: ... FLAG-PLK4 cDNA (CDS) was cloned into the lentiviral pCW57-hygro plasmid (Addgene plasmid, 80922) by double digestion with NheI and BamHI and ligation with T4 ligase ...
-
bioRxiv - Neuroscience 2024Quote: ... were gifts of Didier Trono (Addgene plasmid # 12259; http://n2t.net/addgene:12259; RRID:Addgene_12259; Addgene plasmid # 12260; http://n2t.net/addgene:12260; RRID:Addgene_12260). ALFA and HA tagged LRRTM2 KDR variants for transient expression in HEK cells were generated by replacing the GFP tag in KDR GFP-LRRTM2 previously described8 using NEB HIFI Gibson cloning ...
-
bioRxiv - Cell Biology 2024Quote: The SunTag system plasmids pcDNA4TO-K560-E236A-24xGCN4_v1-IRES-Puro (Addgene plasmid #60909; RRID: Addgene_60909) and pHR-scFv-GCN4-sfGFP-GB1-NLS-dWPRE (Addgene plasmid #60906 ...
-
bioRxiv - Cell Biology 2024Quote: The SunTag system plasmids pcDNA4TO-K560-E236A-24xGCN4_v1-IRES-Puro (Addgene plasmid #60909; RRID: Addgene_60909) and pHR-scFv-GCN4-sfGFP-GB1-NLS-dWPRE (Addgene plasmid #60906 ...
-
bioRxiv - Cancer Biology 2024Quote: ... psPAX2 and pMD2.G were gifts from Didier Trono (Addgene plasmid # 12260; http://n2t.net/addgene:12260; RRID:Addgene_12260; Addgene plasmid # 12259; http://n2t.net/addgene:12259; RRID:Addgene_12259).
-
bioRxiv - Molecular Biology 2024Quote: To create the gRNA plasmid backbone called pSK26_gRNA_Hyg we digested the bRA89 plasmid (Addgene #100950) with the NgoMIV and ClaI restriction enzymes and ligated the 5736 bp fragment onto itself by inserting a short filler fragment digested with the same pair of enzymes ...
-
bioRxiv - Molecular Biology 2024Quote: ... and pET28a(+)6xHis-TEV-IFIT3 were a gift from Kathleen Collins (Addgene plasmid # 53557; http://n2t.net/addgene:53557; RRID:Addgene_53557, Addgene plasmid # 53558; http://n2t.net/addgene:53558; RRID:Addgene_53558 ...
-
bioRxiv - Microbiology 2024Quote: The plasmid encoding the codon-optimized T7 polymerase was obtained from Addgene (plasmid 65974; 34) as was the VSV-G plasmid (pMD2.G ...
-
bioRxiv - Immunology 2024Quote: ... Mtb was transformed with the pTEC15 plasmid (a gift from Lalita Ramakrishnan; Addgene plasmid # 30174)122 or the pMSP12::mCherry plasmid (a gift from Lalita Ramakrishnan ...
-
bioRxiv - Cancer Biology 2019Quote: p53 R248Q was PCR amplified from a bacterial expression plasmid (kind gift of Dr. Shannon Laubert, UCSD) and KRASG12D the pBabe-KRASG12D plasmid (Addgene plasmid 58902, from Dr. Channing Der) using the Kappa Hi-fidelity DNA polymerase (Kappa Biosystems) ...
-
bioRxiv - Immunology 2021Quote: ... TOP10 competent cells were used for all subsequent plasmids except lentiCRISPR v2 (Addgene plasmid no. 52961)43 ...
-
bioRxiv - Cell Biology 2020Quote: ... NG-ABEmax-encoding plasmid wasconstructed in our lab based on the appropriate backbone plasmids (Addgene # 112095).
-
bioRxiv - Immunology 2021Quote: pX330-U6-Chimeric_BB-CBh-hSpCas9 (Plasmid #42230) and lentiCRISPR v2 (Plasmid #52961) were purchased from Addgene. EGFP-tagged mouse NLRP3 was cloned into pBOB empty vector using ligation-independent cloning (LIC ...
-
bioRxiv - Cancer Biology 2019Quote: ... These were then co-transfected with an hCas9 plasmid (gift from George Church, Addgene plasmid #41815). gRNA sequences can be found in Supplementary Table 2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Other plasmids used (for details see excel file S1): pLenti Lifeact-iRFP670 BlastR43 (Addgene Plasmid #84385); pGIZ-PuroR-IRES-GFP_shRNA anti Rab11a/b (Dharmacon) ...
-
bioRxiv - Developmental Biology 2020Quote: ... that result in frameshift mutations were designed using the CRISPR.mit.edu design software and cloned into the Cas9.2A.EGFP plasmid (Plasmid #48138 Addgene). Transfection of gRNA Cas9.2A.EGFP constructs was carried out with Lipofectamine 2000 (ThermoFisher Scientific 11668019 ...
-
bioRxiv - Cell Biology 2022Quote: ... A Rac1 specific gRNA 5’ ACACTTGATGGCCTGCATCA was cloned into plasmid pX330-BbsI-PITCh (Addgene plasmid #127875) and transfected along with pN-PITCh-GFP-Rac1 into HeLa cells using JetPrime (Polyplus ...
-
bioRxiv - Cell Biology 2022Quote: ... mKeima-Red-Mito-7 plasmid was a gift from Michael Davidson (Addgene plasmid #56018; www.addgene.org/56018). MitoTracker Deep Red FM ...
-
bioRxiv - Molecular Biology 2020Quote: ... TbC1 cells were reverse transfected with 400ng of U6>sgRNA plasmids (George Church, Addgene plasmid #41824) according to Table S2 and 3μL Lipofectamin 2000 (Life Technologies) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plasmid HIV-dual-GT including the final sequence is available from AddGene (plasmid ID 122696). Individual CRISPR knock-out plasmids were constructed based on lentiCRISPRv2 (#52961 ...
-
bioRxiv - Genomics 2020Quote: ... Cells were transfected with 0.5 ug gRNA gblock and 2.5 ug px458 plasmid (Addgene plasmid # 48138) containing spCas9 and GFP ...
-
bioRxiv - Cell Biology 2019Quote: ... Flag pLJM1 RagB and RagD plasmids were gifts from David Sabatini (Addgene plasmid 19313 and 19316) (Sancak et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... and Cas9 mRNA was transcribed in vitro from linearized template plasmid pMLM 3613 (Addgene Plasmid #42251). A mixture containing approximately 300ng/μl Cas9 mRNA and 20ng/μl sgRNA was injected into fertilized eggs at the one-cell stage ...
-
bioRxiv - Plant Biology 2019Quote: ... We have also made available a hygromycin-selectable mEGFP plasmid, pH_35S/mEGFP (www.addgene.org, plasmid #135321 (RRID:Addgene_135321)) ...
-
bioRxiv - Cancer Biology 2020Quote: ... This plasmid was a gift from Kai Ge (Addgene plasmid #15548; http://n2t.net/addgene: 15548; RRID:Addgene_15548) (70).
-
bioRxiv - Cancer Biology 2020Quote: ... This plasmid was a gift from Feng Zhang (Addgene plasmid # 52962; http://n2t.net/addgene:52962; RRID:Addgene_52962) (69).
-
bioRxiv - Bioengineering 2021Quote: ... with the following plasmids: lenti-EF1a-dCas9-VPR-Puro plasmid (gift from Kristen Brennand; Addgene, #99373) or the sgRNA expression cassette lentiGuide-Puro (gift from Feng Zhang ...
-
bioRxiv - Biophysics 2021Quote: ... cells were transfected with transgene plasmid together with lentivirus packaging plasmids psPAX2 (Addgene, Cat. No. 12260) and pMD2.G (AddGene ...
-
bioRxiv - Cancer Biology 2021Quote: Lentivirus was generated by transfecting the target plasmid with the packaging plasmids pMD2.G (Addgene: 12259) and psPAX2 (Addgene ...
-
bioRxiv - Cancer Biology 2020Quote: ... List of plasmids used in this work: pCDH-puro-Bcl2 (Cheng et al., Addgene plasmid #46971), Tet-pLKO-puro (Wiederschain et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... the gag/pol plasmid pCMV-dr8.91 and the VSV-g envelope plasmid pMD2.G (Addgene, 12259). The plasmids were diluted in H2O and 2.5 M CaCl2 ...
-
bioRxiv - Cell Biology 2021Quote: ... coli strain was transformed with the pBAD::mRFP1 plasmid (Addgene plasmid #54667; Campbell et al., 2002) or the pZsGreen vector (cat ...
-
bioRxiv - Neuroscience 2022Quote: Ankyrin-G-190-GFP (plasmid #31059) and Ankyrin-B-2XHA (plasmid #31057) were bought from Addgene. The 3XHA-Ankyrin-G domain constructs were gifts from Dr ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmid pMK1334 for lentiviral delivery of sgRNA was a gift from Martin Kampmann (Addgene plasmid #127965). Sequences in transfer vectors were incorporated into lentivirus using the lentiviral packaging system (pMD2.G and psPAX2) ...
-
bioRxiv - Microbiology 2022Quote: ... We introduced this sgRNA-encoding sequence into the pSAG1::Cas9-U6::sgUPRT plasmid (Addgene plasmid 54467) using Q5 mutagenesis (New England Biolabs) ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid pCDNA-3xHA-hTERT was obtained from (Addgene plasmid # 51637 ; http://n2t.net/addgene:51637 ; RRID:Addgene_51637) [27] ...
-
bioRxiv - Neuroscience 2020Quote: ... Lentiviral packaging was performed in HEK 293T cells using commercial plasmids (Addgene plasmids 12259 and 12263) and protocols ...
-
bioRxiv - Microbiology 2021Quote: ... psPAX2 and pMD2.G were a gift from Didier Trono (Addgene plasmid # 12260, Addgene plasmid # 12259) and pLenti CMV GFP Neo (657-2 ...
-
bioRxiv - Cancer Biology 2020Quote: The pKLV-U6gRNA-PGKpuro2ABFP (Plasmid #50946) and the lentiCas9-Blast (Plasmid #52962) were obtained from Addgene. The HSV1-tk/GFP/firefly luciferase (TGL ...
-
bioRxiv - Biochemistry 2021Quote: ... The pcDNA3.1-SC35-cMyc SRSF2 plasmid was a gift from Kathleen Scotto (83) (Addgene plasmid #44721).
-
bioRxiv - Genetics 2022Quote: ... Complementary gRNA oligonucleotides were cloned into pSpCas9(BB)-2A-Puro plasmid (pX459; Addgene plasmid ID# 48139) using the BbsI I site ...
-
bioRxiv - Systems Biology 2022Quote: ... pSNAPf-Cox8A Control Plasmid was a gift from New England Biolabs & Ana Egana (Addgene plasmid # 101129). The primers used for cloning were synthesized by BioTeZ Berlin-Buch GmbH and are listed in Table S3 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... the 4272 bp ORF of Cas9 was amplified from pHsp70 Cas9 plasmid (Addgene plasmid #46294 (32)) using primers BR-666 and BR-667 and cloned into the vector between the zpg promoter and the 3’-UTR for zpg using BbsI for scarless ...
-
bioRxiv - Microbiology 2022Quote: The RNA motif plasmid cloning backbone [(pRMB) (Addgene plasmid # 107253; http://n2t.net/addgene:107253; RRID: Addgene_107253)] and the BASU RaPID plasmid (Addgene plasmid # 107250 ...
-
bioRxiv - Cancer Biology 2022Quote: Plasmid pDONR221-SLC3A2_STOP was a gift from RESOLUTE Consortium & Giulio Superti-Furga (Addgene plasmid # 161379, RRID:Addgene_161379) [40] ...
-
bioRxiv - Cancer Biology 2022Quote: Plasmid pDONR221-SLC3A2_STOP was a gift from RESOLUTE Consortium & Giulio Superti-Furga (Addgene plasmid # 161379, RRID:Addgene_161379) [40] ...
-
bioRxiv - Cell Biology 2022Quote: ... LentiCas9-Blast plasmid (a gift of Feng Zhang, Addgene plasmid # 52962; http://n2t.net/addgene:52962; RRID:Addgene_52962) was used to produce virus in 293T cells which was used to infect RPE-1 and RPE-1-21/3 cell lines ...
-
bioRxiv - Cancer Biology 2019Quote: ... A plasmid for over expression of FGFR1 was a gift from Dominic Esposito (Addgene plasmid #70367) and cloned into an expression vector (pHIV-IRES-mRFP ...
-
bioRxiv - Cancer Biology 2020Quote: ... Blasticidin-resistant cells were subsequently transduced with viral supernatant containing LentiGuide-Puro plasmid (Addgene plasmid #52963) with ligated selected sgRNA ...