Labshake search
Citations for Addgene :
1951 - 2000 of 10000+ citations for Rat FAM24A shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2021Quote: The constitutively activated STAT3 plasmids (STAT3-C Flag pRc/CMV) were purchased from Addgene (Plasmid #8722). C2C12 cells were transiently transfected with STAT3-C plasmids using the Lipofectamine™ 2000 Transfection Reagent according to the manufacturer’s instructions (Life Technology ...
-
bioRxiv - Genetics 2019Quote: ... the DNMT3B2 sequence from pcDNA3/Myc-DNMT3B2 plasmid (Addgene plasmid 36942, a gift from A. Riggs)27 was subcloned using XbaI and BamHI into the pCG plasmid (a gift from N ...
-
bioRxiv - Microbiology 2020Quote: ... The VSV-G encoding plasmid and lentiviral packaging plasmid psPAX2 were obtained from Addgene (Cambridge, MA). The pLenti-GFP lentiviral reporter plasmid that expresses GFP and luciferase was generously gifted by Fang Li ...
-
bioRxiv - Genetics 2020Quote: ... The empty sgRNA plasmid backbone was a kind gift from Keith Joung (BPK1520, Addgene plasmid #65777). The SpCas9 expressing vector was created by using Q5 high fidelity polymerase (NEB ...
-
bioRxiv - Cell Biology 2021Quote: Early passage HeLa-M cells were transfected with 1.5 µg of px459 plasmid (Addgene plasmid #62988) containing a single guide RNA (sgRNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... or pSRE-Luciferase plasmid from ATCC (# MBA-120) together with packaging plasmids pMD2.G (Addgene, #12259), psPAX ...
-
bioRxiv - Synthetic Biology 2021Quote: ... pInt plasmid was a gift from Michele Calos (Addgene plasmid # 18941 ; http://n2t.net/addgene:18941 ; RRID:Addgene_18941) and pTcI-Wasabi was a gift from Mikhail Shapiro (Addgene plasmid # 86101 ...
-
bioRxiv - Biophysics 2021Quote: ... The pMal-Abl-PRM5R plasmid was a generous gift from Michael Rosen’s Lab (Addgene plasmid #112088). The sequence encoding 7x repeats of a PRM from lamellipodin (aa 970-981 ...
-
bioRxiv - Neuroscience 2021Quote: ... APEX2 was amplified from the pcDNA3 APEX2-NES plasmid (gift from Alice Ting, Addgene plasmid #49386) with three sequential sets of primers to add SV40 NLS to both the N-terminus and C-terminus of APEX2 (primer sets 1-3 ...
-
bioRxiv - Cancer Biology 2020Quote: MTR knockout using CRISPR-Cas9 was accomplished using the pLenti-CRISPR v2 plasmid (Addgene Plasmid 49535)58 ...
-
bioRxiv - Biophysics 2021Quote: ... BL21 AI cell was co-transformed with MutS-bio and BirA expression plasmid (Addgene plasmid #20857)70 and was grown in LB containing 50 μg/ml kanamycin ...
-
bioRxiv - Microbiology 2021Quote: ... two constructs (Fig. 1A) were made using a modified pgRNA-bacteria plasmid (NEB, Addgene plasmid # 44251). This plasmid ...
-
bioRxiv - Immunology 2020Quote: ... LeGO-iT2 and LeGO-iT2puro plasmids were gifts from Boris Fehse (Addgene plasmids #25917 and #27343). pcDNA3.1+_C-(K)DYK-ACE2 (NM_021804.2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... HEK293T cells were transfected with lentiviral plasmid and the second-generation packaging plasmids psPAX2 (Addgene, #12260) and pMD2.G (Addgene ...
-
bioRxiv - Genomics 2022Quote: ... Base editor plasmids pCMV_AncBE4max_P2A_GFP and pCMV_ABEmax_P2A_GFP were gifts from David Liu (Addgene plasmid # 112100 and 112101).34 Base editor constructs pCAG-CBE4max-SpG-P2A-EGFP (RTW4552 ...
-
bioRxiv - Immunology 2022Quote: ... LV-TCR plasmids were based on the pRRL backbone derived from pRRLSIN.cPPT.PGK-GFP.WPRE (plasmid #12252, Addgene). The DNA sequences of all plasmids were verified by Sanger sequencing performed by GENEWIZ ...
-
bioRxiv - Neuroscience 2022Quote: The GFP RNAi construct was plasmid L4417 was a gift from Andrew Fire (Addgene plasmid #1649). Bacteria were isolated and grown overnight at 37°C shaking in Luria broth (LB ...
-
bioRxiv - Microbiology 2022Quote: ... which we copied from the EGFP-GalT plasmid (gift from Jennifer Lippincott-Schwartz, Addgene plasmid # 11929) [56] ...
-
bioRxiv - Neuroscience 2022Quote: ... The plasmid version of this construct will be available on Addgene (Addgene Plasmid #174007, RRID:Addgene 174007).
-
bioRxiv - Neuroscience 2022Quote: ... The plasmid version of this construct will be available on Addgene (Addgene Plasmid #174007, RRID:Addgene 174007).
-
bioRxiv - Microbiology 2022Quote: ... Plasmid psPAX2 was a gift from Didier Trono (Addgene plasmid # 12260; http://n2t.net/addgene:12260; RRID:Addgene_12260). pCMV-VSV-G was a gift from Bob Weinberg (Addgene plasmid # 8454 ...
-
bioRxiv - Biophysics 2022Quote: ... the NLS-dCas9-NLS-GFP gene was amplified from plasmid pSLQ1658-dCas9-EGFP (Addgene, plasmid #51023) by PCR and inserted into the BamHI and XhoI restriction sites of the pcDNA5-FRT/TO plasmid (Invitrogen).
-
bioRxiv - Developmental Biology 2024Quote: ... Plasmids used in this protocol were gifted from Kate O’Connor-Giles (Addgene plasmids #45946 and #51434)(Gratz et al. ...
-
bioRxiv - Immunology 2023Quote: ... The transposase plasmid pCMV(CAT)T7-SB100 was a gift from Zsuzsanna Izsvak (Addgene plasmid # 34879). The DUSP1 gene ORF (Ensembl ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were transduced with lentivirus generated from plasmid UCOE-SFFV-dCas9-BFP-KRAB (Addgene plasmid #85969) as described above ...
-
bioRxiv - Genetics 2024Quote: ... These gRNAs were cloned into a plasmid containing Cas9 and a BFP reporter (Addgene Plasmid # 64216) and cutting efficiency was tested in 293T after transient transfection using lipoD293T and the T7E1 assay ...
-
bioRxiv - Genetics 2024Quote: ... These gRNAs were cloned into a plasmid containing Cas9 and a BFP reporter (Addgene Plasmid # 64216) and cutting efficiency was tested in 293T after transient transfection using lipoD293T and the T7E1 assay ...
-
bioRxiv - Immunology 2024Quote: ... The OVA entry fragment was created using a PCR amplicon from OVA plasmid (Addgene plasmid 64599) with primers containing attB sites (Table 1 ...
-
bioRxiv - Neuroscience 2023Quote: ... S499A and S499D plasmids were a gift from Stephanie Ceman (Addgene plasmids #87929, #87913 and #87914). HaloTag versions of FMRP reporters were generated by replacing GFP with HaloTag ...
-
bioRxiv - Cell Biology 2023Quote: ... and was performed by the Leuven Viral Vector Core using transfer plasmids for lentiviral vector production (Addgene, plasmid RRIDs: Addgene_171770, Addgene_171789, Addgene_204474, Addgene_204481, Addgene_171790 ...
-
bioRxiv - Biophysics 2024Quote: ... Lentiviral vectors were co-transfected with the lentiviral packaging plasmids pCMV-VSV-G (Addgene plasmid #8454) and pCMV-dR8.2 (Addgene plasmid #8455 ...
-
bioRxiv - Cell Biology 2024Quote: ... Lentiviral plasmids containing the relevant guides were co-transfected with helper plasmids psPAX2 (Addgene Ref. 12260) and pCMV-VSV-G (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... For N-terminal tagging a repair donor plasmid consisting of mCherry2 (derived from Addgene plasmid # 72831), flanked by a total of 6X Flag repeat epitope tags was generated ...
-
bioRxiv - Immunology 2023Quote: ... was co-transfected with packaging plasmids pCAG-VSVG and psPAX2 (Addgene plasmids 35616 and 12260, respectively). Briefly ...
-
bioRxiv - Developmental Biology 2022Quote: ... A plasmid containing the full-length human FOS cDNA (NM_005252.4) was purchased from Addgene (Plasmid #59140). The full-length FOS cDNA was cloned into the pCS2 vector and FOS mRNA was generated using the mMessage mMachine Sp6 kit (Ambion ...
-
bioRxiv - Synthetic Biology 2023Quote: Plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid #6298832), pU6-sgGFP-NT1 was a gift from Stanley Qi & Jonathan Weissman (Addgene plasmid #46914 ...
-
bioRxiv - Neuroscience 2023Quote: ... and serotype PHP.S or PHP.eB plasmids (a gift from Viviana Gradinaru, Addgene plasmids #103002 and #103005) with PEI Max (Polysciences ...
-
bioRxiv - Microbiology 2022Quote: ... were cloned into the pU6-Universal plasmid (Addgene plasmid number 52694; http://n2t.net/addgene:52694; RRID:Addgene_52694). Parasites were transfected with the pU6-sgRNA plasmid containing the guide for GRA12 (A13 and A14 ...
-
bioRxiv - Microbiology 2023Quote: ... as follows: The plasmid HSV-DYN-hM4Di was a gift from John Neumaier (Addgene plasmid # 53327) [77] ...
-
bioRxiv - Neuroscience 2023Quote: We subcloned split-sfGCaMP6s2 (from pGP-GCaMP6s-27) to another AAV compatible plasmid (Addgene, Plasmid#162374). We removed the M13-sfGFP1-6 fragment by digesting it from clone TOM-M13-cpGFP (Suppl ...
-
bioRxiv - Molecular Biology 2023Quote: ... this plasmid was a gift from Noboru Mizushima (Addgene plasmid #84572, http://n2t.net/addgene:84572; RRID:Addgene_84572) (37) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... al.14 The pCS2-mNG-C (the CMV mNG plasmid) was purchased from Addgene (plasmid #128144).
-
bioRxiv - Biochemistry 2023Quote: ... with the only difference being the use of the pAAV2/8 packing plasmid (Addgene Plasmid #112864) for serotyping ...
-
bioRxiv - Developmental Biology 2023Quote: ... Transformants were obtained by co-injecting this plasmid with a pCFD3-dU6:3gRNA plasmid (Addgene #49410) expressing the gRNA GACGCATTTATGGATGCGGG and screening for 3xPax3dsRED ...
-
bioRxiv - Biochemistry 2023Quote: ... lentiviral plasmids and packaging plasmids (pMD2.5G, Addgene catalog no. 12259 and psPAX2, Addgene catalog no. 12260) were transfected into HEK293T cells using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The tdTomato-luciferase plasmid was generated by recombineering using the following pMuLE system plasmids from Addgene: pMuLE ENTR U6-miR-30 L1-R5 (#62113) ...
-
bioRxiv - Developmental Biology 2023Quote: H2B-EGFP mRNA was transcribed from plasmid #1 pCS-H2B-EGFP (Megason, 2009) (Addgene, Plasmid #53744). To construct pCS2-myrTagRFP-T (plasmid #2) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and FKBP-V-P2A-BFP was cloned from pAW63.YY1.FKBP.knock-in.BFP plasmid (Addgene plasmid #104371). Then ...
-
bioRxiv - Neuroscience 2023Quote: ... and 15μg serotype plasmid (pUCmini-iCAP-PHP.eB, a gift from Viviana Gradinaru 101, Addgene plasmid #103005). Three days following transfection ...
-
bioRxiv - Microbiology 2023Quote: ... as follows: The plasmid HSV-DYN-hM4Di was a gift from John Neumaier (Addgene plasmid # 53327) [37] ...