Labshake search
Citations for Addgene :
1451 - 1500 of 2862 citations for Recombinant Human Epithelial Cell Adhesion Molecule His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... PANO2 and HEK293T cells with plasmids eGFP.KRASG12C-2B.retro.puro (Addgene ID 64372, RRID:Addgene_64372), eGFP.KRASG12C-2A.retro.puro (Addgene ID64373 ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were transfected with 500 ng of LentiCrispR V2 (Addgene plasmid #52961) containing a guide RNA targeting mouse CD81 (GCAACCACAGAGCTACACCT ...
-
bioRxiv - Immunology 2021Quote: ... cells were co-transfected with 15ug of the pLKO.1_GFP (#30323, Addgene) vector containing OXSR1_Sh1 ...
-
bioRxiv - Immunology 2020Quote: Lentivirus was generated using HEK293T cells using packaging vector psPAX2 (Addgene#12260) and envelope plasmid encoding VSV-G ...
-
bioRxiv - Cell Biology 2020Quote: ... into 293T cells along with psPAX and pMD2.G packaging plasmids (Addgene) to produce lentivirus ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were transfected with the pX458 (pSpCas9(BB)-2A-GFP) plasmid (Addgene) carrying a GFP-tagged Cas9 and a guideRNA insert targeting both the K6a and K6b gene (guideRNA sequence ...
-
bioRxiv - Cancer Biology 2021Quote: ... TetR was expressed in cells using pLenti CMV TetR Blast (Addgene #17492). Transduced cells were selected with 5μg/ml blasticidin and bulk cells expressing the TetR protein were clonally isolated in 96-well plates using FACS (BD-Aria) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were labeled with mCherry using the pLV-mCherry vector (Addgene, 36084). EZ-Tet-pLKO- Puro was a gift from Cindy Miranti (Frank et al ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transfected with plasmid pSpCas9(BB)-2A-Puro (PX459; Addgene, #62988) containing sgRNA against Yme1l (GATCCAATATGAGATGTATGCCAAC AAACGTTGGCATACATCTCATATT ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentivirus were prepared by transfecting HEK293T cells with pRSV-rev (Addgene #12253), pMDL-RRE (Addgene ...
-
bioRxiv - Biochemistry 2022Quote: ... 106 cells were nucleofected with 5μg of pCVL.SFFV.d14mClover.Ef1a.HA.NLS.Sce(opt).T2A.TagBFP (Addgene #32627) in 100μL electroporation buffer (Amaxa® Cell Line Nucleofector® Kit V ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were transfected a second time with 2μg pCBASceI plasmid (Addgene #26477) using PEI (Polysciences) ...
-
bioRxiv - Biochemistry 2022Quote: ... U2OS cells were transduced with lentiviral particles prepared with pCVL.TrafficLightReporter.Ef1a.Puro (Addgene #31482) at a low multiplicity of infection and selected with 2 μg/ml puromycin (Gibco) ...
-
bioRxiv - Cancer Biology 2022Quote: ... HEK293T packaging cells were co-transfected with pMDLg/pRRE (Plasmid #12251, Addgene), pRSV-Rev (Plasmid #12253 ...
-
bioRxiv - Cancer Biology 2022Quote: ... for generation of bulk PD-L2-KO cells or luciferase (Addgene #105621) to monitor in vivo bioluminescence following standard procedures ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were transfected with either a control pL-CRISPR.EFS.GFP (15µg, Addgene, 57818)78 or pL-CRISPR.EFS.GFP with cloned sgRNA sequences targeting Ascl1 (CRISPR1-F 5’CACCGCAACGAGCGCGAGCGCAACC-3’ ...
-
bioRxiv - Cancer Biology 2022Quote: HEK293FT cells were transfected with pSIN-PAmCherry-KFERQ-NE (Addgene, Cat# 102365), pLP1 ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were transduced with an inducible system Tet-pLKO-puro (21915, Addgene) encoding an shRNA targeting TARDBP sequence (TRCN0000016038 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Whole cell lysates (200 µg) were incubated with GST-RAF-RBD (Addgene) bound to glutathione agarose beads at 4°C for 1 hour ...
-
bioRxiv - Cancer Biology 2024Quote: ... cell line was transfected with either pBabe-puro-HA-KRASG12C (Addgene, #58901) or pBabe-puro-Empty (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... cells was transfected with 15ng STING (pMSCV-hygro-STING R232, Addgene 102608), 20ng encoding firefly luciferase driven by an IFN-beta promoter (IFN-Beta_pGL3 ...
-
bioRxiv - Cell Biology 2024Quote: B16-F1 cells were transiently transfected with pEGFP-Paxillin (Addgene plasmid #15233) as described above and plated onto 35 mm glass-bottom Ibidi dishes coated with laminin ...
-
bioRxiv - Biochemistry 2024Quote: Cells were transfected with the following expression plasmids: eGFP-NLS (67652, Addgene), pCDH-CMV-hLamin_A-IRES-copGFP-EF1-puro (132773 ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transfected with pEGFP-C1-Centrin-1 plasmid (Addgene, Plasmid # 72641) using Lipofectamine2000 according to the manufacture’s recommendations ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentivirus was produced by transfecting HEK293T cells with viral envelope (VSVG, Addgene) and packaging plasmids (psPAX2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Each plasmid was co-transfected into HEK293T cells with psPAX2 (Addgene, 12260) and pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2024Quote: ... The T-REx293 cell line was transiently transfected with LentiCRISPRv2 (Addgene, #52961). The sgRNA sequences used for cloning LentiCRISPRv2-DHHC5 were ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were transfected with 200 ng of pJC6-GL3 (#11979, Addgene; cJUN), which contains the cJUN promoter linked to the firefly luciferase gene ...
-
bioRxiv - Cell Biology 2023Quote: ... lentivirus was produced by co-transfecting 293T cells with psPAX2 (Addgene; #12260), pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... we transfected Cos7 cells with Cx43-GFP (gift from David Spray (Addgene plasmid #69007 ...
-
bioRxiv - Cancer Biology 2023Quote: ... These cell lines were lentivirally transduced with SpCas9 (Addgene: #52962, Watertown, MA) and selected with blasticidin (InvivoGen ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cas9-expressing cells were transduced in triplicate with a Lenti_sgRNA_EFS_GFP (Addgene #65656) lentivirus that co-expressed an sgRNA and GFP in 96-well plates ...
-
bioRxiv - Cancer Biology 2023Quote: ... we produced lentiviruses in HEK293T cells using TLCV2 lentiviral vector (Addgene #87360) expressing a Tet-inducible CRISPR-Cas9 protein ...
-
bioRxiv - Cancer Biology 2023Quote: ... into 293T cells along with psPAX and pMD2.G packaging plasmids (Addgene) to produce lentivirus ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transiently transfected with mCherry (gift from Michael Davidson, Addgene, 54517), mCherry-tagged CLIMP63 (gift from Gia Voeltz 52 ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were transduced with lentiviral constructs encoding Luciferase and tdTomato (Addgene #72486) or the cell cycle marker PIP-FUCCI (Addgene #118616) ...
-
bioRxiv - Systems Biology 2023Quote: Cells were first transformed with a plasmid expressing Cas9 (Addgene plasmid 43802) (Dicarlo et al ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with KRT5PWT along with eGFPc1-huNFATc1EE-WT (Addgene#24219) as indicated ...
-
bioRxiv - Microbiology 2023Quote: Lentivirus was produced in HEK293T cells via transfection of psPAX2 (Addgene #12260), VSV-G (Addgene #8454) ...
-
bioRxiv - Cell Biology 2023Quote: ... the cells were transfected with the SMO-expressing plasmid (pGEN_mSMO, Addgene #3767329) in OptiMEM medium using FuGENE® HD transfection reagent (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... The other non-NE cells were transfected with H2B-RFP (Addgene 26001) lentivirus ...
-
bioRxiv - Biophysics 2023Quote: ... Cells were transfected with 1 μg of mCherry- Clathrin LC-15 (Addgene) to label clathrin-coated vesicles ...
-
bioRxiv - Molecular Biology 2023Quote: The OSC cells were transfected with the pAc-sgRNA-Cas9Flag plasmid (Addgene plasmid #49330 ...
-
bioRxiv - Cell Biology 2022Quote: ... lentivirus was produced by co-transfecting 293T cells with psPAX2 (Addgene; #12260), pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... into 293T cells along with psPAX and pMD2.G packaging plasmids (Addgene) to produce lentivirus ...
-
bioRxiv - Cancer Biology 2023Quote: ... K562 cells were transduced with lentiviral particles produced using vector pMH0001 (Addgene #85969 ...
-
bioRxiv - Cancer Biology 2023Quote: ... SERPINB3 stable expression cells were generated using pULTRA lentiviral vector (Addgene #24129) containing human SERPINB3 or pLV-C-GFPSpark vector (Sino Biological LVCV-35 ...
-
bioRxiv - Cancer Biology 2022Quote: ... into 293T cells along with psPAX and pMD2.G packaging plasmids (Addgene) to produce lentivirus ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were infected with pHIV-Luc-ZsGreen viral particles (Addgene plasmid # 39196), FACS sorted for ZsGreen expression and used for in vivo experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transiently transfected with pSpCas9(BB)-2A-GFP (PX458; 48138; Addgene) vector encoding a sgRNA targeting PAC (5′-TGTCGAGCCCGACGCGCGTG-3′ ...