Labshake search
Citations for Addgene :
1151 - 1200 of 2254 citations for Mouse Cell Surface Hyaluronidase CEMIP2 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: TIA1 proteins were expressed in the BL21DE3 bacterial cell line from the pET28b plasmid (Addgene) containing the Mus musculus (mouse ...
-
bioRxiv - Cancer Biology 2023Quote: AW13516 cell lines stably expressing either non-targeting scrambled shRNA (#1864) (Addgene, Cambridge, Massachusetts, USA) or shRNAs targeting C1QBP or TRIM23 were employed to study the effect of knockdown on the tumorigenic potential of cancer cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... These constructs were packed into lentivirus by transient transfection in 293T cells with psPAX2 (Addgene) and the ecotropic MLV envelope pCAG-Eco using calcium phosphate as described (57) ...
-
bioRxiv - Systems Biology 2022Quote: ... 240 million cells were transduced with lentivirus from the Human Genome-wide CRISPRi-v2 (Addgene #83969 ...
-
bioRxiv - Systems Biology 2023Quote: ... All pEN_TT donor vectors were LR recombined with either pSLIK zeo (B2B1 cells; Addgene #25736) or pSLIK neo (TM15c6 cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... ANBL6 cells were infected with lentiviruses carrying pCMV-T7-SpCas9-P2A-EGFP (Addgene, plasmid # 139987) construct and GFP+ cells were selected using FACS.
-
bioRxiv - Cancer Biology 2023Quote: ... CHMp and CHMm cells were transfected with a firefly luciferase gene-carrying plasmid (Addgene #18964) using Lipofectamine 3000 reagent (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... Jurkat cells were co-transfected with Cas9-mCherry (pU6-CBh-Cas9-T2A-mCherry: Addgene 64324) and gRNA-BFP (pKLV2.2-h7SKgRNA-hU6gRNA-PGKpuroBFP ...
-
bioRxiv - Molecular Biology 2023Quote: ... Jurkat cells were co-transfected with Cas9-BFP (pU6-CBh-Cas9-T2A-BFP: Addgene 64323) and gRNA (pSPgRNA ...
-
bioRxiv - Cell Biology 2024Quote: ... 293FT cells were co-transfected with 1.86 μg psPAX2 (gift from Didier Trono, Addgene #12260), 1 μg VSVG (gift from Bob Weinberg ...
-
bioRxiv - Immunology 2024Quote: All constructs were cotransfected into HEK293T cells with lentiviral packaging vectors psPAX (Addgene cat#12260) and pMD2.g (Addgene cat#12259 ...
-
bioRxiv - Cell Biology 2024Quote: ... Reporter cells were transfected in parallel with pCAGGS-mCherry (a gift from Phil Sharp; Addgene plasmid #41583 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... cells were co-transfected with enveloping (pCMV14-3X-Flag-SARS-CoV-2 S (Addgene #145780) for PVs or pMD2.G (Addgene #12259 ...
-
bioRxiv - Cell Biology 2024Quote: Plasmids used for mammalian cell expression of Eps15 variants were derived from Eps15-pmCherryN1 (Addgene plasmid #27696 ...
-
bioRxiv - Microbiology 2024Quote: ... Caco2-Cas9 and Caco2-dCas9 cells were generated by transducing with pLX311-Cas9 (Addgene #118018) and pLenti-dCas9-VP64-Blast (Addgene #61425) ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells that were transfected with a plasmid alone were transfected with GFP-Mapper (Addgene 117721) or C1ORF43-FLAG (SinoBiologic ...
-
bioRxiv - Microbiology 2024Quote: The TR146 cells were transduced with lentivirus that carried the spCas9-Blast construct (Addgene, #52962) at MOI = 0.3 as described above ...
-
Sex-specific perturbations of neuronal development caused by mutations in the autism risk gene DDX3XbioRxiv - Neuroscience 2024Quote: ... and cells were then transduced with 1 µl of AAV8-Ef1a-mCherry-IRES-Cre (Addgene, #55632-AAV8 ...
-
bioRxiv - Physiology 2024Quote: ... To induce the MCM2 overexpression these cells were transfected with MCM2 overexpressing plasmid (Addgene# 54164), using Lipofectamine 3000 reagent (Invitrogen) ...
-
bioRxiv - Cancer Biology 2024Quote: ... EFEMP1 overexpression was achieved by transduced cells with FL-fibulin-3 pcDNA4 (Addgene, Plasmid 29700) (Hu et al ...
-
bioRxiv - Genomics 2024Quote: ... cells were transfected with Casilio-imaging components containing 50 ng of dCas9 plasmid (Addgene #73169), 50 ng of Clover-PUFc plasmid (Addgene #73689) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Lentiviral particles were generated by transfecting 293T cells with 1.5 µg ps-PAX2 (Addgene #12260), 0.5 µg pCMV-VSV-G (Addgene # 8454 ...
-
bioRxiv - Bioengineering 2024Quote: ... and the following morning the cells were transfected with 12.1 µg pMD2.G (Addgene #12259), 18.15 µg psPAX2 (Addgene #12260 ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were transfected with 0.5 µg of the following plasmids: pMRXIP-GFP-STX7 (45921; Addgene), pmCherry-N1-VAMP8 (92424 ...
-
bioRxiv - Cell Biology 2024Quote: ... Lentiviruses were produced by transfecting Lenti-X 293T cells with pMD2.VSVG (Addgene plasmid #12259) and psPAX2 (Addgene plasmid #12260) ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were transduced with lentivirus carrying the lenti sgRNA(MS2)_puro construct (Addgene, Cat# 73795) into which guide sequences were cloned and overexpression of the target genes was confirmed by RT-qPCR.
-
bioRxiv - Cancer Biology 2024Quote: ... Viral media was collected from HEK293FT cells transfected with the 7TFP lentiviral plasmid (Addgene #24308), along with the PAX2 (packaging ...
-
bioRxiv - Cancer Biology 2024Quote: ... NPsh cell lines were transduced to stably express Cas9 with the lentiCas9-blast (Addgene #52962) lentiviral backbone and selected with 10 ug/mL blasticidin ...
-
bioRxiv - Cell Biology 2020Quote: ... TALENs were constructed according to the instruction provided by the TALE Toolbox kit from the Zhang laboratory (Sanjana et al., 2012) (Addgene, #1000000019). The target sequences for the left arm ...
-
bioRxiv - Genetics 2020Quote: ... The same kit was used to produce Cas9 D10A mRNA using as template the plasmid pCAG-T3-hCasD10A-pA (Addgene #51638). The 140bp ssDNA homology direct repair (HDR ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: GPCR coding sequences were provided by Bryan Roth (University of North Carolina, Chapel Hill, NC; PRESTO-Tango Kit—#1000000068, Addgene, Watertown), MA ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: GPCR coding sequences were provided by Bryan Roth (University of North Carolina, Chapel Hill, NC; PRESTO-Tango Kit - #1000000068, Addgene, Watertown), MA ...
-
bioRxiv - Developmental Biology 2021Quote: Minos transposase mRNA was generated using the ThermoFisher mMESSAGE mMACHINE T7 or T7 ULTRA kit using NotI-digested pBlueSK-MimRNA (Addgene #102535). mRNA and concentrated DNA were mixed into a final concentration of 1 µg/µL in a solution of 0.1% phenol red in nuclease-free water ...
-
bioRxiv - Developmental Biology 2021Quote: ... were designed on ZiFiT (http://zifit.partners.org/ZiFiT/) and constructed using the Joung Lab REAL Assembly TALEN kit (a gift from Keith Joung; Addgene, Cambridge, MA, #1000000017), according to the provided protocol (Sander et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... were cloned by PCR amplification of the full-length human GPCR cDNA library (hORFeome database 8.1) or the PRESTO-Tango GPCR Kit36 (Addgene Kit #1000000068). To optimize the 5-HT sensors ...
-
bioRxiv - Microbiology 2022Quote: ... insertion of was performed by ClonExpress II One Step Cloning Kit (Vazyme, China) with SpeI-digested pENTR4-FnCas12a and TetR amplicon of plasmid pFREE vector (Addgene, #92050) with the primer pair Tet-F3/Tet-R3 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The previously described GIRK1-F137S hometetramerization mutant 63 was used for patch clamp recordings and the ONE-Go Gαi3 biosensor (Addgene kit #1000000224) was used for BRET measurements ...
-
bioRxiv - Cell Biology 2020Quote: hES cells (H1) were thawed at P29 and transfected with 3.3µM of each hCas9D10A (Addgene #74495), and a gRNA/donor plasmid (pUC_lmnA_Neo_exn1_donor_fixed containing gRNA sequence GCAGGAGCTCAATGATCGCTTGG ...
-
bioRxiv - Immunology 2021Quote: ... TOP10 competent cells were used for all subsequent plasmids except lentiCRISPR v2 (Addgene plasmid no. 52961)43 ...
-
bioRxiv - Cell Biology 2020Quote: ... we transiently transfected MCF7 and SMMC-7721 cells with the Utrophin-GFP reporter (Plasmid #26737, Addgene) using X-tremeGENE HP DNA Ttransfection Reagent (Roche) ...
-
bioRxiv - Molecular Biology 2020Quote: HeLa cells were infected with lentivirus carrying the Cas9-BFP (blue fluorescent protein) vector (Addgene 52962). HCT116 and HEK293T were transfected with the same vector using Lipofectamine 2000 (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: ... HEK293/HEK293T cells stably transduced with the Wnt reporter Super TOP-Flash (STF, Addgene Plasmid #12456) were previously described (Bauer et al ...
-
bioRxiv - Biochemistry 2022Quote: ... these cells were transduced with lentiviral particles for TetO-Fuw empty vector (Addgene plasmid number 85747)(30) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 6cm dishes of cells were transfected with 1ug of guide RNA expressing px300 plasmid (#42230, Addgene) and 1ug of each HDR template/NHEJ PCR product ...
-
bioRxiv - Molecular Biology 2020Quote: ... TbC1 cells were reverse transfected with 400ng of U6>sgRNA plasmids (George Church, Addgene plasmid #41824) according to Table S2 and 3μL Lipofectamin 2000 (Life Technologies) ...
-
bioRxiv - Cell Biology 2022Quote: ... and TAX1BP1 KO HeLa cells were cotransfected with the DNA fragment and the PX459 (Addgene #48139)-based plasmid expressing Cas9 and gRNA (GGGGCCACTAGGGACAGGAT) ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transduced by thermosensitive retroviral gene transfer of SV40 T antigen (LOX-CW-CRE, Addgene) at a MOI of 5 in Proliferation UREC medium with 8μg/mL polybrene (64) ...
-
bioRxiv - Genomics 2020Quote: ... Cells were transfected with 0.5 ug gRNA gblock and 2.5 ug px458 plasmid (Addgene plasmid # 48138) containing spCas9 and GFP ...
-
bioRxiv - Cancer Biology 2020Quote: Cas9-expressing p185+ B-ALL cells were transduced with the Brie CRISPR KO library (Addgene #73633) at a multiplicity of infection of 0.5 with an sgRNA coverage of 400x (24) ...
-
bioRxiv - Genetics 2021Quote: ... HEK293T cells were transfected using calcium phosphate with psPAX2 (gift from Didier Trono, Addgene No.12260), pCAG-Eco (gift from Arthur Nienhuis and Patrick Salmon ...