Labshake search
Citations for Addgene :
951 - 1000 of 2254 citations for Mouse Cell Surface Hyaluronidase CEMIP2 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: To determine the cytosolic volume of all cell lines pEGFP-N1 (Addgene# 6085-1) was transiently overexpressed ...
-
bioRxiv - Cell Biology 2020Quote: ... Lentiviral particles were produced in HEK-293T cells with the vectors psPAX2 (12259, Addgene), pMD2.G (12259 ...
-
bioRxiv - Cell Biology 2020Quote: Coilin-KO cells were generated using the Cas9 nickase system (pX335 and pKN7; Addgene) [Cong et al ...
-
bioRxiv - Cell Biology 2022Quote: Cas9-expressing J774 cells were transduced with lentivirus based on pMCB320 (Addgene plasmid #89359) with mCherry replaced by BFP and containing the sgRNA sequences given in the table below ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were co-transfected with 750 ng of pCMV-PE2 Plasmid (Addgene Plasmid #132775) and 250 ng of assembled pU6-pegRNA-GG-acceptor using Lipofectamine 2000 (Invitrogen) ...
-
Activation of the Integrated Stress Response overcomes multidrug resistance in FBXW7-deficient cellsbioRxiv - Cancer Biology 2022Quote: ... Each cell line was also infected with the empty pLentiCRISPR v2 vector (Addgene, 52961) to be used as controls ...
-
bioRxiv - Microbiology 2022Quote: ... coli DH10Bac cells following transformation with the pFastBac LIC cloning vector (4A) (Addgene #30111) containing a cloned copy of the AAV4 VP1 gene ...
-
bioRxiv - Genetics 2022Quote: ... HEK- 293T cells were transfected with 100 ng pIS0 (Addgene #12178, encoding firefly luciferase), 100 ng of the Renilla reporter and 800 ng of empty vector (1 µg total plasmid DNA ...
-
bioRxiv - Microbiology 2022Quote: MGAT1 and C1GALT1 KO A549 cells were generated using the lentiCRISPR v2 (#52961, Addgene) single vector system as previously described with Puromycin selection (Sanjana et al. ...
-
bioRxiv - Genomics 2022Quote: A549 cells expanded from a single clone harboring a doxycycline-inducible Cas9 (Addgene #114010) were a gift from J.T ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentivirus was generated in 293T cells by calcium phosphate cotransfection with psPAX2 (Addgene #12260), pCMV-VSV-g (Addgene #8454) ...
-
Kinetochore- and chromosome-driven transition of microtubules into bundles promotes spindle assemblybioRxiv - Cell Biology 2022Quote: ... unlabeled HeLa-TDS cells were transfected with CENP-B-INCENP-GFP (Addgene, plasmid #45238), and for live-cell imaging also with mCherry-PRC1 plasmid provided by Casper C ...
-
bioRxiv - Cancer Biology 2022Quote: ... RPE1 hTERT cells were retrovirally infected with pBABE c-Myc-ER plasmid (Addgene, 19128), infected cells were selected in 5μg/ml puromycin and the surviving polyclonal population was used in further assays ...
-
bioRxiv - Biophysics 2022Quote: ... These cells were infected with a lentiviral vector expressing pCMV-CheRiff-CFP (Addgene 136636) to render them light sensitive.
-
bioRxiv - Developmental Biology 2021Quote: ... and 8×105 cells were electroporated with 2 μg Cas9-sgRNA plasmid (Addgene: #48139), 1 µg pEGFP-Puro and 200μM (6.6 μg ...
-
bioRxiv - Molecular Biology 2020Quote: ... HCT116-Cas9 cell line was generated by lentiviral transduction with lentiCas9-Blast (Addgene # 52962) and selection with 4 μg/mL of blasticidin (Sigma ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cas9-expressing HAP1 cell line was established by using lentiCas9-Blast plasmid (#52962, Addgene). To generate NSUN2-KO ...
-
bioRxiv - Biophysics 2021Quote: ... for the live-cell time-lapse experiment and with pcDNA3.1(+)eGFP (Addgene plasmid #129020) for the FFS measurements ...
-
bioRxiv - Cancer Biology 2021Quote: A549 cells were stably transduced with a lentiviral vector containing H2B-GFP (Addgene #25999) and a lentiviral vector containing DHB-iRFP ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were then transduced with the following virus: pTet-O-NGN2-puro (Addgene #52047): 0.1 μL per 5×104 cells ...
-
bioRxiv - Developmental Biology 2020Quote: Lentiviral transfer vectors were transfected into 293T cells with packaging vector pspax2 (Addgene 12260) and envelop vector vsvg using linear polyethylenimine ...
-
bioRxiv - Molecular Biology 2021Quote: ... lentiviruses were produced in HEK293T cells in a pLKO.1-puro (Addgene, plasmid 8453) backbone ...
-
bioRxiv - Genomics 2021Quote: ... IMR90 cells were transfected with 1 µg of pEGFP-Δ50 LMNA (Addgene Plasmid #17653). After expression of the GFP was observed (∼2 days) ...
-
bioRxiv - Bioengineering 2020Quote: ... U87-EGFP cells were created by infection with lentivirus made from pLL3.7 (Addgene #11795). The drug screens were performed by the Quellos High Throughput Screening Core (University of Washington ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 million cells were nucleofected with iμg pAAV-CAG-GFP plasmid DNA (Addgene 37825) in Ingenio electroporation buffer (Mirus MIR50111 ...
-
bioRxiv - Immunology 2021Quote: ... human embryonic kidney 293T/17 cells were transfected with pcDNA3.1(-)hACE2 (Addgene plasmid #1786). Transfection was performed in 293T/17 cells using the genejuice (Novagen ...
-
bioRxiv - Cell Biology 2021Quote: Lentivirus was generated in 293T cells using delta 8.9 and pHCMV-EcoEnv (Addgene 15802) as packaging plasmids and 25kDa linear PEI as a transfection agent ...
-
bioRxiv - Cancer Biology 2021Quote: ... 293T cells were transfected with lentiviral packaging vectors (3 μg pSPAX2 (Addgene plasmid, 12260) and 1 μg pMD2.G (Addgene plasmid ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA from RPE1 cells was cloned into pLenti CMVie-IRES-BlastR (Addgene plasmid #119863). PAXIP1 W75R ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were transfected with 0.24μg EGFP-LC3 plasmid DNA (Addgene #11546; Watertown, MA, USA) using the FUGENE6 transfection reagent (Promega ...
-
bioRxiv - Biophysics 2023Quote: ... Cells were transfected with paxillin-pEGFP (a gift from Rick Horwitz; Addgene plasmid #15233) using a microporator (Neon Transfection System ...
-
bioRxiv - Biochemistry 2023Quote: ... and TEV protease cleavage site into an insect cell expression vector (Addgene plasmid #55218). The same expression construct was cloned into a bacterial expression vector (Addgene plasmid #29708) ...
-
bioRxiv - Cancer Biology 2023Quote: ... KMS11 or JJN3 cells were transduced with the pCW-Cas9-Blast vector (#83481, Addgene) to establish stable Cas9+KMS11 and Cas9+JJN3 cells ...
-
bioRxiv - Cancer Biology 2023Quote: VUMC-ATRT-01 cells were transduced (lentiviral) with a LentiCRISPR v2 plasmid (#52961, Addgene) that was cloned with a p53-sgRNA (Supplementary table S2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Lysosome/autophagosome fusion was estimated in ARPE19 cells overexpressing only GFP-LC3 (24920, Addgene) or both GFP-LC3 and AKT2 constructs ...
-
bioRxiv - Cell Biology 2023Quote: ... purified from bacteria cells transformed with the plasmid pET-28b-RfxCas13d-His (Addgene 141322), was kindly provided by JP Concordet ...
-
bioRxiv - Genomics 2023Quote: K562 CRISPRi cells were transduced with the hCRISPRi-v2 top 5 library (Addgene #83969)138 with 840X representation ...
-
bioRxiv - Genetics 2023Quote: ... 293T cells were transfected with the plasmids pCMVR8.74 (a gift from Didier Trono (Addgene plasmid #22036 ...
-
Astroglia proliferate upon biogenesis of tunneling nanotubes and clearance of α-synuclein toxicitiesbioRxiv - Cell Biology 2023Quote: One population of U-87 MG cells were transiently transfected with pLV-mitoDsRed (Addgene #44386 ...
-
bioRxiv - Neuroscience 2023Quote: ... At DIV0 cells were infected with either AAV-Cre-GFP-hSyn (Addgene, 105540-AAV9) or AAV-GFP (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... and PEI transfected into HEK293T cells along with pUMVC retroviral packaging construct (Addgene # 8449) and VSVG envelope construct (Addgene #8454) ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... carbenicillin/ampicillin resistance was introduced into NA22 competent cells using pUC1975 (Addgene, product #50005) to generate strain PXKR1 ...
-
bioRxiv - Cell Biology 2023Quote: The producer cell line HEK 293TN was transfected with the packaging (psPAX2, Addgene 12260), envelope (pMD2.G ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were co-transfected with 750 ng of pCMV-PE2 Plasmid (Addgene Plasmid #132775) and 250 ng of assembled pU6-pegRNA-GG-acceptor using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Molecular Biology 2022Quote: HEK293T cells (∼107) were transiently transfected with either pRK5-MYC-mTOR (Addgene plasmid #1861) or pRK5-MYC-mTOR kinase-dead (Addgene plasmid #8482) ...
-
bioRxiv - Cell Biology 2024Quote: ... AICSDP-82:SON-mEGFP was a gift from Allen Institute for Cell Science (Addgene plasmid # 133964 ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were transduced with lentivirus generated from the PIP-FUCCI plasmid (Addgene plasmid #138715) as described above ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cells were sequentially transduced with lentiviruses of the lentiCRISPR-Puro (Addgene plasmid #52961) expressing Tp53 sgRNA (CCTCGAGCTCCCTCTGAGCC ...
-
bioRxiv - Cancer Biology 2024Quote: H1299 cells were engineered with stable Cas9 expression using Lenti-Cas9-blast (Addgene #52962). Efficient nuclease activity was confirmed using a reporter system (Addgene #67979 ...
-
bioRxiv - Cancer Biology 2024Quote: HT29 cells previously infected with pLenti-U6-tdTomatato-P2A-BlasR (LRT2B) virus (Addgene, 1108545) that enables dual production of firefly luciferase and TdTomato were used ...