Labshake search
Citations for Addgene :
701 - 750 of 819 citations for PCR Buffers since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Human Synapsin1 promoter and smFP-HA were PCR amplified from pAAV-hSyn-EGFP (a gift from Bryan Roth, Addgene Plasmid #50465) and pCAG_smFP-HA (a gift from Loren Looger ...
-
bioRxiv - Cell Biology 2023Quote: ... The oDi sequence encoding a coiled-coil dimerization domain was amplified by PCR (#503/#504) from SpyCatcher002-oDi (a gift from Mark Howarth, Addgene # 124661) (Khairil Anuar et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... the oTet sequence encoding a tetramerization coiled-coil domain was obtained by PCR (#505/#506) from SpyCatcher002-oTet (a gift from Mark Howarth, Addgene # 124663) (Khairil Anuar et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... Mapt exon 4 and flanking the intron regions were PCR amplified using Phusion High-Fidelity DNA polymerase and inserted into NheI/BamHI digested pFlareA Plasmid (Addgene, 90249) and sequenced ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Synthetic enhancers were amplified by PCR with primers that included homology to the plasmid vector E1b-GFP-Tol2 (Addgene plasmid #37845)81 and were cloned upstream of the minimal promoter (E1b ...
-
bioRxiv - Neuroscience 2023Quote: ... the transgene p130PH or p130PHR134L were amplified using PCR from the pEGFP-N1 plasmids containing these genes31 and inserted into the Ef1α-DIO-mCherry viral vector (Addgene, #47636). AAVTM6 viruses were produced at Janelia Viral Tools facility ...
-
bioRxiv - Bioengineering 2023Quote: ... the scFv-GCN4-linker-VP16-GB1-Rex NLS sequence was PCR amplified from pHRdSV40-scFv-GCN4-sfGFP-VP64-GB1-NLS (Addgene #60904) and cloned into a lentiviral backbone containing an EF1-alpha promoter ...
-
bioRxiv - Molecular Biology 2023Quote: Polymerase chain reaction (PCR) was used to isolate mouse AMPKγ1 cDNA from a mouse AMPKγ1-HA vector (#40605, Addgene, Watertown, MA, USA). Mouse AMPKγ1 cDNA was then cloned into the 3xFLAG-CMV10 vector (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... digesting the PCR generated fragment with HindIII and BamHI restriction enzymes and finally cloning it into the ptdTomato-C1 vector (Addgene, #54653), previously digested with HindIII and BamHI restriction enzymes.
-
bioRxiv - Cell Biology 2023Quote: ... PH-FFAT/N-PH-FFAT sequences (5’-NheI/3’-AscI) were amplified by PCR from pLJM1-FLAG-GFP-OSBP plasmid (Addgene#134659). The sequences encoding Twitch (Twitch2b/Twitch7x/Twitch8x/Twitch9x ...
-
bioRxiv - Cell Biology 2023Quote: ... the strain expressing Hfl1-NG was produced from strain Y1508 by introducing a DNA fragment obtained by PCR using plasmid pFA6a-link-ymNeongreen-SpHis5 (Addgene, #125704) and oligonucleotides #1706 ...
-
bioRxiv - Cell Biology 2023Quote: pENTR H2B mScarlet-I was created by PCR amplification of mScarlet-I from plasmid EB3- mScarlet-I (Addgene #98826, Dorus Gadella), using the primers FW 5’- ACCGGTGAATTCACCATGGTGAGCAAGGGCG-3’ and RV 5’-
-
bioRxiv - Plant Biology 2023Quote: A pair of oligos containing the gRNA sequence were used in conjunction with vector-specific primers (Table S1) for PCR amplification of Medicago truncatula U6 promoter and scaffold from the pUC-gRNA plasmid (Addgene #47024) using Q5® High-Fidelity 2X Master Mix (New England Biolabs) ...
-
bioRxiv - Neuroscience 2023Quote: ... The construct encoding SARS-CoV-2 matrix (M) protein was cloned by PCR amplification of M cDNA from the pDONR 207 SARS-CoV-2 M plasmid (Addgene #141274) using a Forward primer inserting a restriction site for EcoRI and a reverse primer bearing a restriction site for BamHI and a Myc tag ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The ERdd GFP LEU2 donor plasmid SHe146 (Supplementary Data S4) was cloned by Golden Gate assembly from parts PCR amplified from pScDD2_ERdd (Addgene plasmid #109047), pWS082 (Addgene plasmid #90516) ...
-
bioRxiv - Developmental Biology 2023Quote: An enhanced piggyBac Puromycin selectable and DOX inducible vector was digested with EcoRI-NotI and ligated with PCR-amplified human SOX2 from the FUW-tetO-hSOX2 plasmid (Addgene#20724). Transfection into hPSCs was done using Lipofectamine Stem Reagent per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... we amplified a 10xHis-MBP coding fragment by PCR with primers pair 10xHis-MBP-F and 10xHis-MBP-R from pMAL-c2X® vector (Addgene), and cloned it into pTrcHis® vector (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: The spectinomycin resistance cassette (promoter, aadA CDS and terminator) was PCR-amplified from pAGM1299 (Addgene plasmid # 47988; (Weber et al., 2011)) using Phusion high-fidelity DNA polymerase (New England Biolabs Ltd ...
-
bioRxiv - Bioengineering 2023Quote: ... The P2A-mScarlet fragment was obtained by PCR cloning from pEB2-mScarlet (a kind gift from Dr. Philippe Cluzel; Addgene #104006)(Balleza et al. ...
-
bioRxiv - Genetics 2023Quote: ... We generated SiT-ddCas12a-[Repr] by introducing the DNase-inactivating E993A by PCR-based mutagenesis using SiT-Cas12a-[Repr] (Addgene #133568) as template ...
-
bioRxiv - Bioengineering 2023Quote: ... the lentiviral transfer plasmid constitutively expressing hM3D(Gq)-mCherry was constructed as follows: the sequence encoding hM3D(Gq)-mCherry was amplified by PCR from a plasmid from Addgene (#50474) and assembled into a lentiviral backbone with a human EF1α promoter ...
-
bioRxiv - Molecular Biology 2023Quote: pLEX-FLAG-Cre-GFP was generated by cloning PCR-amplified N-terminal FLAG tagged Cre-GFP (from pCAG-Cre-GFP; Addgene #13776) (Forward primer ...
-
bioRxiv - Cell Biology 2023Quote: pLVX-EF1a-H2B-emiRFP703-neo was created by PCR of H2B-emiRFP703 from pH2B-emiRP703 (a gift from Vladislav Verkhusha, AddGene #136567) with forward primer (with prepended NotI digest site ...
-
bioRxiv - Cell Biology 2023Quote: ... pLV-mRuby3-MLC-IRES-Neo was created by PCR-amplifying MLC (MYL9) and mRuby3 using pLV-Ftractin-mRuby3-p2A-mTurquoise-MLC-IRES-Blast as templates (Addgene 85146) and by inserting the products into BamHI/NotI-digested pLV-EF1a-IRES-Neo31 (Addgene 85139 ...
-
bioRxiv - Developmental Biology 2024Quote: ... gcgtgtgttcccagatgtat) and PCR donor generated with primers AP677/678 (5’Biotin::taagtgccaaggctgccaggcgtgtgttcccagaaacaccccaggaatcaacc and 5’Biotin::gtttttactcacccgatcgcctttctcaccaatacacttgtcatcgtcatccttg) on plasmid AP635 (Addgene #99485). Genotyping shows scarless insertion in the coding sequence ...
-
bioRxiv - Genomics 2024Quote: ... a lentiviral vector was prepared by PCR amplification of the corresponding cassettes from pCMV-PEmax-P2A-hMLH1dn and subsequent insertion into pLenti-PE2-BSD (Addgene #161514), which had been digested with EcoRI and XbaI (#R0145S & #R3101S ...
-
bioRxiv - Synthetic Biology 2023Quote: ... DNA constructs were generated via standard molecular biology techniques including overlap extension PCR and restriction site-based cloning and ligated directly into pENTR1a no ccdB (Addgene 17398) or the MMLV-based retroviral vector LZRS-Rfa (Addgene 31601) ...
-
bioRxiv - Cell Biology 2023Quote: ... OMM-CaM*-CFAST10 was generated by amplifying by PCR the sequence encoding mutated Calmodulin (CaM*) from the plasmid pCMV CEPIA3mt (Addgene #58219). The CaM*-encoding fragment was then ligated between the OMM-targeting sequence and the CFAST10-encoding sequence in the OMM-short-CFAST10 plasmid described above.
-
bioRxiv - Neuroscience 2024Quote: pAAV CAG-FLEx-FLPo was constructed by in-fusion-based PCR cloning utilizing the following two DNA fragments: i) SalI-AscI restriction fragment of pAAV CAG-FLEx-TCb (Addgene #48332) as a vector backbone ...
-
bioRxiv - Neuroscience 2023Quote: ... the coding sequence of the extracellular region of human TfR1 (residues 89–760) were amplified by PCR and inserted into pCMV6-XL4 FLAG-NGRN-Fc (Addgene #115773) with EcoRV and XbaI sites ...
-
bioRxiv - Cell Biology 2024Quote: To construct the ER-GCaMP fused to mRuby3, mRuby3 was PCR amplified from the pKanCMV-mRuby3-18aa-actin (Bajar et al., 2016) (Addgene #74255). CMV ER-GCaMP6-210 was restriction digested with AgeI-HF and combined with the PCR amplified mRuby3 via ligation ...
-
bioRxiv - Cell Biology 2023Quote: The PM-targeting sequence MyrPalm was amplified by PCR and ligated at the 5’ of the cameleon D1cpv-encoding sequence (Addgene #37479) into pcDNA3.
-
bioRxiv - Neuroscience 2024Quote: ... that was first PCR amplified using custom primers (see Table 2) from a plasmid containing lexAop2 (lexAop2-myr-4xSNAPf, RRID: Addgene 87638) and then restriction digested using HindIII and PspXI (New England BioLabs ...
-
bioRxiv - Molecular Biology 2024Quote: Plasmids for microinjection were generated by amplifying the coding and flanking sequences from MT7 genomic DNA and introducing them with the PCR-based method CPEC (Quan & Tian, 2011) into the L4440 plasmid (Addgene, USA). DevPF1 was expressed with its endogenous flanking regions (304 bp upstream of the DevPF1 start codon and 272 bp downstream of the DevPF1 stop codon) ...
-
bioRxiv - Cell Biology 2024Quote: ... an ORF containing the mCherry coding sequence was generated by PCR using pSJ1321 (a gift from Sue Jaspersen73, Addgene plasmid #86413) as a template and primers with BamHI and PacI restriction enzyme recognition sites ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lentiviral constructs expressing TRMT1-WT or TRMT1-Q530N were generated by T5 Exonuclease DNA Assembly (TEDA) of PCR fragments into pLenti-CMV-GFP-Blast (Addgene 17445) (Xia et al ...
-
bioRxiv - Molecular Biology 2020Quote: ... The resin was washed 6 times with lysis buffer (supplemented with 100 nM USP2 (purified in-house from Addgene plasmid 36894) for de-ubiquitinated TOP2B) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 × 105 cells were resuspended in 10 μL of R-buffer with 0.5–2 μg of the EMTB 3x EGFP plasmid (a gift from William Bennett, Addgene plasmid 26741). Cells were exposed to three pulses of amplitude 1325 V and duration 10 ms in the electroporator ...
-
bioRxiv - Neuroscience 2023Quote: ... The 40% iodixanol layer after ultracentrifugation was collected and buffer exchanged with DPBS using Amicon Ultra centrifugal filters (#Z648043, Millipore) (modified protocol from Addgene, USA). We performed quantitative PCR on the viral stocks and the titer was determined as approximately 1.9 x 1012 genomic copies/ml for S5E2-lox dTom lox rcGFP lox2 and 1.1 x 1012 genomic copies/ml for S5E2-lox ChR2 mCh lox.
-
bioRxiv - Cell Biology 2020Quote: Human SH3 domain nucleotides (hLynSH3, amino acids 63-123) were amplified by PCR and cloned into a mammalian expression vector pEBG (Addgene, plasmid # 22227) with an N-terminal glutathione S-transferase (GST ...
-
bioRxiv - Cell Biology 2020Quote: ... primary miRNAs for miR-29a and miR-16 were amplified from genomic DNA by PCR and cloned into the pAdTrack shuttle (Addgene, Plasmid#16404). The miR-16 pAdTrack plasmid was then mutated by site-directed mutagenesis to induce 3 point mutations into the miR-16 seed sequence ...
-
bioRxiv - Developmental Biology 2021Quote: ... Tol2-mCherry was produced by digesting Tol2-EGFP-C1 with NheI/EcoRI to remove GFP and inserting mCherry amplified by PCR from 8xGliBS-IVS2-mCherry-NLS-polyA-Tol2 (a gift from James Chen (Addgene plasmid #84604), Mich et al ...
-
bioRxiv - Developmental Biology 2020Quote: ... DBD and AD sequences along with the Drosophila synthetic minimal core promoter (DSCP) region were amplified using PCR from vectors pBPZpGal4DBDUw and pBPp65ADZpUw (Addgene clone 26234) using primers that added NotI and AvrII restriction sites (CTGATCGCGGCCGCAAAGTGGTGATAAACGGCCGGC and GATCAGCCTAGGGTGGATCTAAACGAGTTTTTAAGCAAACTCAC) ...
-
bioRxiv - Cancer Biology 2022Quote: A Piggybac version of the FUCCI reporter (BII-ChPtW-iresFUCCI) was constructed by PCR amplification of the Clover-Geminin-ires-mKO2-Cdt fragment from pLL3.7 (Addgene Plasmid #83841, [33]) and insertion into unique BsmBI sites within the Piggybac vector BII-ChPtW ...
-
bioRxiv - Molecular Biology 2020Quote: dCas9 repressor was PCR-amplified with primers containing SfiI sites from dCas9-KRAB-MeCP2 (a gift from Alejandro Chavez & George Church; Addgene plasmid #110821) (Yeo et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... a fragment encoding the residues 1382-1690 was cloned by PCR as a XhoI-NotI fragment from the pFRT/TO/FLAG/HA-DEST TNRC6C vector (Addgene plasmid 19885) (52 ...
-
bioRxiv - Immunology 2021Quote: ... GFP-YVAD was PCR-amplified from pEGFP-C3 and cloned into the Lamp1-RFP plasmid (a gift from Walter Mothes; RRID: Addgene Cat.#1817) (Sherer et al. ...
-
bioRxiv - Microbiology 2019Quote: ... fused by SOE PCR with the amilCP coding sequence obtained from PGR-Blue (44) (which was a gift from Nathan Reyna; Addgene plasmid #68374) using prJL49 and prJL50 ...
-
bioRxiv - Genomics 2019Quote: ... The ScFV-sfGFP-GB1-NLSSV40 fragment was amplified by PCR from plasmid pHR-scFv-GCN4-sfGFP-GB1-NLS-dWPRE (Addgene Plasmid # 60906) and then ligated into PiggyBac plasmid pB-TRE3G-BsmBI-EF1α-HygroR-P2A-rtTA by Golden Gate Assembly with enzyme BsmBI and T4 ligase (NEB).
-
bioRxiv - Systems Biology 2019Quote: For pPB - mCherry vector construction a PCR product encoding GCaMP5 sensor incorporating the CaMP3 mutation T302L R303P D380Y and no stop codon (Addgene plasmid #31788) was directionally ligated into pENTR/D-TOPO vector (Invitrogen K243520 ...