Labshake search
Citations for Addgene :
301 - 350 of 819 citations for PCR Buffers since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... cDNAs were amplified with PCR and subcloned into the pHR-hSyn-EGFP vector (Addgene #114215) along with a T2A-NLS-mApple minigene for fluorescent visualization ...
-
bioRxiv - Cell Biology 2023Quote: ... the M13-encoding sequence was amplified by PCR from the plasmid pCMV CEPIA3mt (Addgene #58219) and ligated between the ER-membrane targeting sequence and the NFAST-encoding sequence in the above described ER-NFAST plasmid ...
-
bioRxiv - Cell Biology 2024Quote: ... The Cry2 fragment was amplified by PCR from the plasmid pHR-mCh-Cry2WT (Addgene, #101221) with primer set #2 (Supplementary Table 1 ...
-
bioRxiv - Molecular Biology 2024Quote: The coding sequence of V5::TurboID was PCR-amplified from V5-TurboID-NES_pcDNA3 (#107169; Addgene). The two fragments were then ligated into the XhoI-digested pUASz1.0 vector using In-Fusion ...
-
bioRxiv - Cell Biology 2024Quote: Human Pcdhga9 mutants were generated by cloning PCR-amplified fragments into pBob-GFP vector (Addgene). For GFP-tagged constructs ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplicons containing spacer sequences for two sgRNAs were generated from plasmid pCFD6 (Addgene 73915) using primers sgRNAampfwd ...
-
bioRxiv - Cell Biology 2024Quote: ... The Cry2 fragment was amplified by PCR from the plasmid pHR-mCh-Cry2WT (Addgene, #101221) with primer set #2 (Supplementary Table 1 ...
-
bioRxiv - Cell Biology 2024Quote: ... the FUS was amplified by PCR from the plasmid pHR-FUSN-mCh-Cry2WT (Addgene, #101223) with primer set #3 (Supplementary Table 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... PCR amplified and cloned between SalI and XbaI sites of pAV-U6+27 (Addgene, plasmid #25709) to yield pAV-U6+27-RhoBAST2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The SunTag (24 x GCN4 peptides) was PCR amplified from the plasmid pcDNA4TO-24xGCN4_v4_sfGFP (Addgene #61058) (Tanenbaum et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR-amplified from a previously assembled vector (ppk10779-T2A-QF2-SV40, 3xP3-dsRed, Addgene accession #130667)
-
A human cancer cell line initiates DNA replication normally in the absence of ORC5 and ORC2 proteinsbioRxiv - Molecular Biology 2020Quote: ... ORC2 sgRNA (GAAGGAGCGAGCGCAGCTTT) was cloned into pCR-Blunt II- TOPO vector backbone (Addgene 41820, Cambridge, MA) using PCR and In-Fusion cloning (Clontech) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The Luc2TdTomato cassette was PCR amplified from the pcDNA3.1(+)/Luc2=TdT plasmid (Addgene, https://www.addgene.org/32904/)9 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Bp::PhiC31 was made by PCR-amplifying the PhiC31 coding region from pPhiC31o54 (Addgene plasmid #13794) using an Xma1-tagged forward primer and a BsrG1-tagged reverse primer (see Supplementary Table S1) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Homology arms were PCR amplified and cloned into pHD-dsRed-attP (Gratz et al.,2014) (Addgene). Guide RNAs and the donor vector were co-injected into nosP Cas9 attP embryos at the following concentrations ...
-
bioRxiv - Developmental Biology 2020Quote: Mouse YAP cDNAs were isolated by PCR amplification using DNA templates obtained from Addgene (Watertown, MA) and cloned into a shuttle vector at Creative-Biogene (Shirley ...
-
bioRxiv - Neuroscience 2019Quote: The Sy-EKAR vector was created by PCR amplification of EKAR-GFP/RFP (38; Addgene #18680) to which a 4Gly linker domain (GGTGGCGGTGGA ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA encoding TNKS ARC1-5 (aa 174-985) was subcloned by PCR into pFLAG-CMV2 (Addgene.org). All vectors subcloned using PCR were sequenced on both strands for verification.
-
bioRxiv - Microbiology 2021Quote: ... the 3xmCherry cassette was PCR amplified from pGGC026 (pGGC026 was a gift from Jan Lohmann (Addgene plasmid # 48831 ...
-
bioRxiv - Microbiology 2020Quote: ... CASP8 ORF was amplified from pcDNA3-CASP8 by PCR (Addgene #11817, a gift from Guy Salvesen) (Stennicke & Salvesen ...
-
bioRxiv - Synthetic Biology 2021Quote: ... by combining a PCR-amplified FNLS-APOBEC1 DNA from pLenti-TRE3G-FNLS-PGK-Puro (Addgene# 110847), PCR-amplified Cas9n-NG DNA from pX330-SpCas9-NG (Addgene# 117919) ...
-
bioRxiv - Molecular Biology 2022Quote: ... we carried out PCR to amplify the mScarlet sequence from the ITPKA-mScarlet plasmid (Addgene, USA) as well as the GRB2 sequence from GRB2-YFP (gift from J ...
-
bioRxiv - Biochemistry 2022Quote: ... and rat TRPM8 were amplified by PCR and subcloned into p3xFLAG-eYFP-CMV-7.1 vector (Addgene) at the NotI/BamHI sites or into 8xHis-MBP pFastBac1 modified with a CMV promoter (obtained from David Julius’ lab ...
-
bioRxiv - Cell Biology 2022Quote: ... The mNeonGreen2 sequence was PCR amplified from pLenti6.2_mNeonGreen2 (a gift from Vanessa LaPointe; Addgene plasmid # 113727) and was inserted in the AscI tagging site using Gibson assembly.
-
bioRxiv - Neuroscience 2020Quote: ... Two guides RNAs were selected and produced by PCR using the pX330 plasmid (Addgene, Watertown, MA) as a template ...
-
bioRxiv - Molecular Biology 2021Quote: ... The HaloTag sequence was obtained by PCR from pENTR4-HaloTag (gift from Eric Campeau, Addgene #29644). The donor plasmids for the ΔCTD ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragment encoding human 4R1N full length tau were amplified by PCR using tau cDNA (Addgene). And then the DNA fragment encoding 4R1N tau were inserted into the linearized pHR-mCh-Cry2Olig backbone using In-Fusion Cloning Kit (Takara) ...
-
bioRxiv - Neuroscience 2021Quote: ... the U6-BbsI/BbsI cassette was PCR amplified from px458 (Addgene #48138, (Ran et al., 2013)) (forward ...
-
bioRxiv - Cell Biology 2022Quote: ... we Gibson assembled a PCR product containing CMV-StrepKDEL-IRES-SBP (amplified from Addgene plasmid #65295) to the SalI/MluI digested piggyback backbone (a generous gift from Jonathon Nixon-Abell ...
-
bioRxiv - Molecular Biology 2019Quote: ... the MCP-VP64-IRES-mCherry cassette was PCR amplified from the pJZC34 vector (Addgene, plasmid # 62331) and cloned into BsrGI/EcoRI digested lenti-sgRNA (MS2)-zeo backbone (Addgene ...
-
bioRxiv - Microbiology 2019Quote: ... PCR amplification of the cassette via Q5 polymerase for sticky-end cloning into vector pRS306 (Addgene) after restriction with the enzymes XhoI and XbaI led to plasmid pBBA5.1 ...
-
bioRxiv - Genomics 2019Quote: ... The minimal promoter and luciferase insert was prepared using biotinylated PCR primers (Amp_minPLuc2_Biotin_For and Amp_minPLuc2_Biotin_Rev) corresponding to pMPRAdonor2 (Addgene plasmid #49353) and Kapa HiFi HotStart ReadyMix (Kapa Biosystems) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... GEM effector expression cassette together with the LEU2 marker was PCR amplified from pHES83917 (Addgene # 87941) using primers OZL348 and OZL349 and integrated downstream of the YFL033C locus of SZL149 and SZL281 (SZL149+msh2Δ) ...
-
bioRxiv - Biochemistry 2020Quote: ... The PCR product contained arms of homology to the acceptor plasmid (SM-KDM5B-MS2; Addgene #81084). The acceptor plasmid was cut with NheI (New England BioLabs ...
-
bioRxiv - Biochemistry 2020Quote: ... The PCR product contained arms of homology to the acceptor plasmid (SM-KDM5B-MS2 Addgene #81084). The acceptor plasmid was cut with NotI (New England BioLabs ...
-
bioRxiv - Cell Biology 2019Quote: ... His-tagged SEPT5 plasmid was constructed by PCR amplifying SEPT5 from pCMV-Myc-tagged SEPT5 (Addgene plasmid # 27272 ...
-
bioRxiv - Cell Biology 2019Quote: ... followed by PCR amplification and insertion of 2A-PuroR (a gift from Brett Stringer; Addgene 98290) and TagBFP ...
-
bioRxiv - Genomics 2021Quote: We used PCR to add V5 epitope tags to the 3’ end of FoxA1 (Addgene #120438) and Hnf4a (Addgene #120450 ...
-
bioRxiv - Developmental Biology 2022Quote: LSSmKate2 and mBeRFP were individually amplified by PCR with specific primers from pLSSmKate2-N1 (Addgene #31867) and LK1-MpEF1+mBeRFP+Nos-T35S-T (gift from F ...
-
bioRxiv - Cell Biology 2020Quote: ... the fragment encoding EGFP-SV40 PolyA was PCR amplified from the pcDNA3-hL1 plasmid (Addgene #89411) with primers Fwd ...
-
bioRxiv - Cell Biology 2020Quote: ... the fragment encoding the hL1CAM ORF was PCR amplified from the pcDNA3-hL1 plasmid (Addgene #89411) with primers Fwd ...
-
bioRxiv - Molecular Biology 2021Quote: Notch1 and Jagged1 constructs were generated by polymerase chain reaction (PCR) using mouse Notch1 (Addgene 41728), human Notch1 (kind gift of Dr ...
-
bioRxiv - Genomics 2021Quote: ... pLuc2-PromLDLR was created by PCR expansion of the target luciferase from pGL4Luc-RLuc (Addgene 64034), custom gene synthesis of the LDLR promoter (NCBI Reference Sequence NG_009060.1 ...
-
bioRxiv - Genetics 2020Quote: ... The BamHI/ XhoI digested NCL PCR product was cloned into BamHI/ XhoI digested pGPD2 (Addgene; #43972). The NCL-ΔRGG plasmid was similarly created using primers NCL-For and NCLΔRGG-1XHA Rev (Table S1) ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragment encoding human 4R1N full length tau were amplified by PCR using tau cDNA (Addgene). And then the DNA fragment encoding 4R1N tau were inserted into the linearized pHR-mCh-Cry2Olig backbone using In-Fusion Cloning Kit (Takara) ...
-
ADAR2 deaminase activity promotes Th17 effector function and protects against intestine inflammationbioRxiv - Immunology 2022Quote: ... The amplified PCR products were ligated to the NotI and SalI linearized MSCV vector (RRID: Addgene_17442). The MSCV murine ADAR2E396A expression construct was generated using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR-amplified ORF inserts were Gibson assembled into NcoI-HF- and XhoI-digested pET-21a(+) (Addgene) and then transformed into E ...
-
bioRxiv - Cell Biology 2022Quote: ... scFV-HAtag-sfGFP-GBI was PCR-amplified from pHR-scFv-GCN4-sfGFP-GB1-dWPRE (Addgene, #60907) and inserted between the NheI and HindIII sites of the pcDNA-puro vector.
-
bioRxiv - Cell Biology 2022Quote: ... strain MB921 was transformed with PCR product obtained using plasmid pFA6a-GFP(S65T)-kanmx6 (Addgene 39292) and oligonucleotide primers Cut7-Cterm-pFA6a-GFP/paGFP-F and Cut7-Cterm-pFA6a-GFP/paGFP-R ...
-
bioRxiv - Cell Biology 2022Quote: ... strain MB1147 was transformed with PCR product obtained using plasmid pFA6a-GFP(S65T)-kanmx6 (Addgene 39292) and oligonucleotide primers Cut7-988-Cterm-pFA6a-GFP-F (TTAAAGGGAACGACATCACTTGCTAATCATACTAATGAATTACTTGGTTTAG-GAGATGAACGGATCCCCGGGTTAATTAA ...