Labshake search
Citations for Addgene :
801 - 850 of 867 citations for PCR Buffers since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... and then the entire expression cassette was PCR amplified and cloned into the PacI and BglII sites of the plasmid HO-hisG-URA3-hisG-poly-HO (Addgene plasmid #51661). The integrating inducible yeast expression vectors for N-terminally FLAG-tagged human JNK1 (isoform α1 ...
-
bioRxiv - Biophysics 2021Quote: ... a bacterial expression plasmid pBADGCaMP6s was first created by PCR amplification of the GCaMP6s gene from pGP-CMV-GCaMP6s (Addgene Plasmid #40753), followed by a Gibson Assembly (New England Biolabs ...
-
bioRxiv - Neuroscience 2022Quote: ... mutation that converts threonine 154 into alanine) were PCR-amplified from pTRE-TIGHT-Cx43-eYFP (gifted from Robin Shaw; Addgene Plasmid #31807) and cloned into the pcDNA3.1-HA (gifted from Oskar Laur ...
-
bioRxiv - Neuroscience 2022Quote: ... Yap1 and Yap1-5SA with attB sites were amplified PCR (polymerase chain reaction) from pQCXIH-Myc-Yap1(5SA) (a kind gift from Kunliang Guan, Addgene plasmid # 33093) and pcDNA3-Yap1 (a kind gift from Stefano Piccolo ...
-
bioRxiv - Molecular Biology 2020Quote: ... Both optogenetic receptors were assembled through an initial generation of a vector backbone through PCR amplification of opto-mFGFR (a gift from Harald Janovjak, Addgene plasmid #58745) to omit the mFGFR coding region ...
-
bioRxiv - Immunology 2022Quote: ... pTRIPZ-puro-HA-Ub was generated by Gibson assembly by PCR amplification of HA-tagged ubiquitin gene from the plasmid HA-Ubiquitin which was a gift from Edward Yeh (Addgene plasmid # 18712) and pTRIPZ-puro digested with AgeI and XhoI ...
-
bioRxiv - Cell Biology 2019Quote: ... and the sequence follows 5’-atgagtcggtctggcaaccaggtgtcggagtacatctcaaacacatttctcgataagcaacatgaagtggaaatcccctctccaacgcagaaggaaaaagaggaggaggaagagccgatgtcgcagatcagtggggtcaagaagttgatgcacagctccagcctaactaattcatgtatc-3’ Templates for in vitro transcription of the sgRNAs were PCR amplified from the pX335 plasmid (a gift from Feng Zhang, Addgene plasmid # 42335) using the following primers ...
-
bioRxiv - Systems Biology 2019Quote: ... we performed inverse PCR using F primer (5’-TGAGCGGCCGCTAGGTACCTTTAA-3’) and R primer (5’-GGCACCGGGCTTGCGGGTCATGCA-3’) and pKLV-U6gRNA-EF(BbsI)-PGKpuro2ABFP (Addgene, Plasmid #62348) as a template ...
-
bioRxiv - Cell Biology 2020Quote: ... the SV40 terminator sequence was PCR-amplified from plasmid pSBtet-GP (pSBtet-GP was a gift from Eric Kowarz, Addgene plasmid # 60495) (Kowarz et al. ...
-
bioRxiv - Microbiology 2021Quote: ... coli Top10 by blunt-end ligation of a fragment generated with a PCR with Jwu267 and Jwu184 and psgRNA29 plasmid as a template (psgRNA was a gift from David Bikard; Addgene plasmid # 114005), gRNA sequence is ACTGGCTAATGCACCCAGTA.
-
bioRxiv - Microbiology 2021Quote: ... The fusion PCR product was ligated using the NotI and AscI restriction sites into an expression plasmid obtained from Addgene (plasmid # 114561) in frame with the mouse constant IgG2a heavy chain46 ...
-
bioRxiv - Systems Biology 2021Quote: ... The 12xMBS-PBS sequence was PCR-amplified from plasmid Pcr4-12xMBS-PBS (Wu et al., 2014) (gift from Robert Singer; Addgene plasmid #52984) and cloned after the stop codon of the reporter gene sequence ...
-
bioRxiv - Systems Biology 2021Quote: ... The iRFP670 coding sequence was PCR-amplified from plasmid pNLS-iRFP670 (Shcherbakova and Verkhusha, 2013) (gift from Vladislav Verkhusha (Addgene plasmid #45466) with a primer containing the CAAX motif and cloned in place of the firefly luciferase gene into plasmid pDN100 (Niopek et al. ...
-
bioRxiv - Evolutionary Biology 2021Quote: Plasmids encoding primate CEACAM1 N-domains were constructed by assembly PCR and ligation independent cloning (LIC) into the pcDNA3 GFP LIC vector (6D) (a gift from Scott Gradia; Addgene plasmid #30127). A detailed description of the assembly PCRs is provided in the Supplementary file 7 and the DNA oligomers and templates are described in Supplementary files 8 and 9 ...
-
bioRxiv - Biochemistry 2021Quote: ... Templates used to create the PCR fragments were pTwist-EF1alpha-SARS-CoV-2-S-2xStrep (gift from Nevan Krogan; Addgene plasmid #141382), pCEP4-myc-ACE2 (gift from Erik Procko ...
-
Sunday driver mediates multi-compartment Golgi outposts defects induced by amyloid precursor proteinbioRxiv - Neuroscience 2021Quote: ... and EGFP cDNA were amplified by PCR and transferred into the vector pJFRC2-10×UAS-IVS-mCD8-GFP (plasmid #: 26214, Addgene, Cambridge, MA). The construct was then injected into embryos of PBac{y[+]-attP-3B}VK00033 to generate transgenic flies ...
-
bioRxiv - Evolutionary Biology 2021Quote: Significant results from the MPRA assay of interest were amplified by PCR and cloned into the pLS-mP-Luc vector (Addgene Cat# 106253) in place of GFP ...
-
bioRxiv - Immunology 2020Quote: ... TCRα or TCRβ chains were amplificated from the corresponding nested PCR mixtures and cloned into the lentivirus vector pWPXL (Addgene Plasmid #12257). The constant regions were replaced by mouse counterparts with improved TCR pairing and TCR/CD3 stability that were convenient for the detection of TCR-T cells (Cohen et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... substituting VPR for KRAB-MeCP2 via PCR amplification from the original dCas9-KRAB-MeCP2 vector (a gift from Alejandro Chavez & George Church (Addgene plasmid #11082145)) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and then ligated with NheI/Bsp1407I-digested mEGFP insert that was obtained from a PCR reaction using AAVS1-mEGFP (Addgene Plasmid #91565) as the template DNA.
-
bioRxiv - Biochemistry 2022Quote: ... The HTT expression constructs were assembled using the BD In-Fusion PCR cloning kit in the mammalian/insect cell vector pBMDEL (Addgene plasmid #111751), an unencumbered vector created for open distribution of these reagents.
-
bioRxiv - Cell Biology 2022Quote: ... SA-KDEL-IRES and SBP PCR fragments were separately amplified from Str-KDEL_SBP-EGFP-GPI (gift from Franck Perez, Addgene plasmid #65294; RRID:Addgene_65294)28 ...
-
bioRxiv - Neuroscience 2023Quote: ... A human Sirt3-RFP driven by the CaMKII promoter was constructed through PCR of the human Sirt3 sequence from Sirt3-FLAG (Addgene plasmid 13814)5 into the BamHI and AgeI sites of CaMKII-MICU3-RFP plasmid6 resulting in the linker sequence RPVVA joining Sirt3 and RFP sequences.
-
bioRxiv - Developmental Biology 2024Quote: Kaede mRNA was produced using the HiScribe™ T7 ARCA mRNA Kit (with tailing) by New England Biolabs (Catalog #E2060S) from a PCR-amplified template of the Kaede-NLS plasmid sourced from Addgene (Plasmid #57319). After mRNA synthesis ...
-
bioRxiv - Microbiology 2023Quote: ... ∼1,000 bp directly upstream and downstream of the l-ldh gene were amplified for each strain and the PCR products were cloned into the pIMAY (for S. epidermidis NIHLM087; Addgene Plasmid #68939) and pJSC232 (for C ...
-
bioRxiv - Neuroscience 2023Quote: ... the U6 promoter and scaffold sequences were PCR amplified from pMJ117 and pMJ179 (gifts from Jonathan Weissman, Addgene plasmid #85997 and #85996). The smFP-V5 (a gift from Loren Looger ...
-
bioRxiv - Microbiology 2023Quote: ... resistance flanked by the 5’ region of VDU and part of the VDU coding sequence was prepared by PCR using the plasmid pTREX-b-NLS-hSpCas9 (a gift from Rick Tarleton, Addgene plasmid #62543) as template and the donor TcVDU84BlastFOW and donor TcVDU84BlastREV ...
-
bioRxiv - Cell Biology 2023Quote: The CRISPR HR oligo was generated by PCR using UPRT F and UPRT R primers and the 5’UPRT-pAPT1-APT1-Halo-3’UPRT plasmid as a template with Q5 high fidelity polymerase and 50ul of PCR reaction was cotransfected with 25 μg of pSag1::Cas9::U6::sgUPRT plasmid [45] (AddGene plasmid # 54467) into 1×107 TgMyoF-mAID parasites [39] ...
-
bioRxiv - Cell Biology 2023Quote: The CRISPR HR oligo was generated by PCR using UPRT F and UPRT R primers and the 5’UPRT-pAPT1-APT1-EmGFP-3’UPRT plasmid as a template with Q5 high fidelity polymerase and 50ul of PCR reaction was cotransfected with 25 μg of pSag1::Cas9::U6::sgUPRT plasmid [45] (AddGene plasmid # 54467) into 1×107 TgMyoF-mAID parasites [39] ...
-
bioRxiv - Biochemistry 2022Quote: ... To produce recombinant CK2 kinase the CKA2 gene was PCR amplified from yeast cDNA library and cloned into a pOPINF vector (a kind gift from Ray Owens, Addgene plasmid 26042) to encode a 3C-cleavable His6 fusion protein ...
-
bioRxiv - Cell Biology 2022Quote: ... To produce EGFP-APEX2-ARHGAP29 the ARHGAP29 cDNA was sub-cloned into the C1-A2E vector (65) by PCR using HA-ARHGAP29 (Addgene plasmid #104154) as a template ...
-
bioRxiv - Cell Biology 2023Quote: ... In a second step, this resulting plasmid and a PCR fragment amplified from pmTurquoise2-NES (Goedhart et al., 2012) (Addgene Plasmid# 36206) with primers 5’-TCAGTTGCTAGCCTCAAGCTTCGAATTCTG-3’ and 5’-AGAGTCAGCTCGAGATATCTTGTACGAGTCCAG-3’ ...
-
bioRxiv - Biophysics 2023Quote: ... The resulting PCR products were then digested with XhoI and KpnI and cloned into a BacMam expression vector (pEZT-BM, Addgene plasmid # 74099)45 ...
-
bioRxiv - Cell Biology 2023Quote: ... The KT binding domain sequence of 53BP1 (aa 1235-1616) was PCR-amplified from pcDNA5-FRT/TO-eGFP-53BP1 (Addgene plasmid #60813) and cloned into pB66 downstream to the Gal4 DNA-binding domain ...
-
bioRxiv - Cell Biology 2023Quote: ... GFP-Sec61β in pBabe puro (a generous gift from Indra Chandrasekar) was created by PCR amplifying Sec61β (a gift from Gia Voeltz, Addgene plasmid #49154) and recombining into XhoI-SalI cut GFP pBabe puro ...
-
bioRxiv - Immunology 2023Quote: ... The homology directed repair (HDR) template was generated by PCR from a template plasmid (a gift from Alexander Marson, Addgene plasmid #112021)(45 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5’ and 3’ fragments containing incorporated mutated gene ORF sequences were amplified by PCR from the pDONR223-TP53 WT plasmid (Addgene; Plasmid #82754). In this case ...
-
bioRxiv - Biochemistry 2024Quote: We also constructed pFGH1-UTG-mTagBFP2 as empty vectors by inserting PCR-amplified mTagBFP2 from pLKO.1 - TRC (a gift from Timothy Ryan; Addgene plasmid #191566) into digested backbone from pFGH1-UTG ...
-
bioRxiv - Cell Biology 2024Quote: ... a fragment containing mTurquoise2 and the mSTING CDN was amplified by PCR and cloned in a pLex306 backbone (David Root, Addgene plasmid #41391). The sequence of E ...
-
bioRxiv - Molecular Biology 2024Quote: ... mCherry was PCR amplified from plasmid DNA with the primers GGGGACAACTTTTCTATACAAAGTTGACATGGTCTCAAAGGGTGAAGAAG and GGGGACAACTTTATTATACAAAGTTGTTTACTTATACAATTCATCCATG and cloned into pDONR 221 P4r-P3r (Addgene plasmid #121527). The miR-58 hairpin sequence and 100 bp upstream and 1000 bp downstream was amplified from wild type genomic DNA and cloned into pDONR 221 P3-P2 ...
-
bioRxiv - Neuroscience 2019Quote: ... For pIRESneo3-Str-KDEL_SBP-EGFP-Nrxn1α a PCR fragment was inserted into pIRESneo3-Str-KDEL_SBP-EGFP-GPI (kindly provided by Franck Perez, Institute Curie, France; Addgene plasmid #65294; RRID: Addgene_65294) digested with FseI and PacI ...
-
bioRxiv - Cell Biology 2022Quote: ... Cloning of KNL1RVSF/AAAA-dCas9 was achieved by inserting KNL1 PCR product (aa1-86, amplified from Addgene plasmid #45225, (Liu et al., 2010)) into XhoI-digested pENTR-dCas9 (no ATG ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNAs were used as PCR templates for cloning into modified pFastBac vectors (derivatives of 438-A and 438-C; Addgene 55218 and 55220) by ligation independent cloning (LIC)37 ...
-
bioRxiv - Cell Biology 2019Quote: ... pCytoplasm GFP was constructed by inserting PCR fragments of histone H3 promoter and the GFP ORF sequentially into the backbone vector pFGL1010 (Addgene #119081, sulfonylurea resistance); NOX1 and NOX2 deletion constructs were generated by inserting PCR amplified 5’ UTR and 3’ UTR fragments of the target genes sequentially into backbone vector pFGL821 (Addgene #58223 ...
-
bioRxiv - Cell Biology 2019Quote: ... NOX1 and NOX2 deletion constructs were generated by inserting PCR amplified 5’ UTR and 3’ UTR fragments of the target genes sequentially into backbone vector pFGL821 (Addgene #58223, hygromycin resistance), flanking the HPH (hygromycin B phosphotransferase ...
-
bioRxiv - Genetics 2020Quote: ... from pBPZpGAL4DBDUw or a p65AD-Zip-containing PCR fragment amplified with oligo pair 3857/3858 from pBPp65ADZpUw (both plasmids (Addgene 26233 and 26234) were gifts from Gerald Rubin (Pfeiffer et al. ...
-
bioRxiv - Microbiology 2020Quote: ... aureus dCas9 was PCR amplified from pX603-AAV-CMV::NLS-dSaCas9(D10A,N580A)-NLS-3xHA-bGHpA (a gift from Dr. F. Zhang; Addgene plasmid # 61594 (39)) and inserted into a derivative of pBOMB4-Tet::L2 (kind gift of Dr ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNAs coding for eIF4A1 and eIF4A1DQAD were PCR-amplified using primers TS64/TS65 and cloned into mTurquoise-C1 and mCitrine-C1 vectors (Addgene #54842 and #54587) using HindIII and BamHI restriction sites ...
-
bioRxiv - Molecular Biology 2022Quote: ... Two donor plasmids were generated by overlap PCR ∼500bp Ythdc1 genomic sequence flanking BSD/HygR-P2A-mAID-mCherry2 sequence (Addgene plasmid #121180, #121183) and cloning into pMD20-T vectors by T-A ligation ...
-
bioRxiv - Genetics 2024Quote: ... We next used the Gateway™ LR Clonase™ II Enzyme mix to recombine each of the four PCR products into the pBID-UASC-G backbone (Addgene Plasmid #35202), which contains a φC31 integrase compatible attB sequence and UAS binding sites for the GAL4 expression system (Wang et al ...