Labshake search
Citations for Addgene :
501 - 550 of 867 citations for PCR Buffers since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Mitigating a TDP-43 proteinopathy by targeting ataxin-2 using RNA-targeting CRISPR effector proteinsbioRxiv - Bioengineering 2023Quote: ... PCR was used to amplify the T2A-EGFP sequence from pXR001 (Addgene #109049; a gift from Patrick Hsu44) using the primers T2A-GFP Gibson Forward and Reverse (Supplementary Table 1) ...
-
Bni5 tethers myosin-II to septins to enhance retrograde actin flow and the robustness of cytokinesisbioRxiv - Cell Biology 2023Quote: ... The resultant PCR products were subcloned into BamHI- and SspI-digested pET-His6-Sumo-TEV-LIC (Addgene # 29659) using in-fusion cloning kit (Takara ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The DNA fragments of TPPP FL and FKBP were produced by PCR using existing templates and (Addgene #31184). The tagBFP gene was synthesized as gBlocks (Integrated DNA Technologies) ...
-
bioRxiv - Neuroscience 2024Quote: ... with PCR of the hDlxI56i enhancer and minimal beta globin promoter from hDlxI56i-minBglobin-iCre-4X2C (Addgene #164450). hDlxI56i eGFP plasmid was made by cutting CMV-eGFP-synapsin (Chi et al. ...
-
bioRxiv - Plant Biology 2024Quote: ... the corresponding cDNA was amplified by PCR and cloned into the expression vector pDEST-HisMBP (Addgene plasmid #11085) using standard GATEWAYTM procedures ...
-
bioRxiv - Cell Biology 2024Quote: ... IST1-EGFP was generated by PCR amplifying IST1 from HA-IST1 (Addgene plasmid # 131619 ; http://n2t.net/addgene:131619 ; RRID:Addgene_131619) and subcloning into the EGFP-N1 (Clontech ...
-
bioRxiv - Plant Biology 2024Quote: ... the CDS of AtPHF1 and AtPHO1 were amplified by PCR and subcloned into UBQ10:sXVE: S10-(MCS) (Addgene plasmid # 108177 ...
-
bioRxiv - Plant Biology 2024Quote: ... the CDS of AtPHT1;1 and AtPHO2 were amplified by PCR and subcloned into UBQ10:sXVE: (MCS)-S11 (Addgene plasmid # 108179 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Kozak sequence was added to RCaMP1h by PCR using RCaMP1h cDNA from pRSET-RCaMP1h plasmid (Addgene plasmid #42874) as the template ...
-
bioRxiv - Synthetic Biology 2020Quote: The library was synthesized by Agilent and then resuspended in 100 uL of elution buffer before cloning into plasmid pLibacceptorV2 (Addgene ID no. 106250). The transcription factor spacing library was ordered separate from the other libraries ...
-
bioRxiv - Cell Biology 2022Quote: ... These oligos were annealed in annealing buffer (10 mM Tris pH 7.5-8.0, 50 mM NaCl, 1 mM EDTA) as recommended by Addgene (https://www.addgene.org/protocols/annealed-oligo-cloning) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The resulting PCR fragments were cloned into pJUMP27 (pJUMP27-1AsfGFP was a gift from Chris French, Addgene plasmid #126974) (45 ...
-
bioRxiv - Molecular Biology 2021Quote: ... a region bearing six let-7 binding sites was PCR-amplified from MSCV puro let-7 sponge (Addgene #29766) and cloned between AgeI and EcoRI sites downstream of GFP.
-
bioRxiv - Cancer Biology 2020Quote: ... The PCR product was digested with EcoRI and ligated into EcoRI digested pHR-SFFV-KRAB-dCas9 vector (Addgene, 60954), to generate a pHR-pTRE3G-KRAB-dCas9 vector ...
-
bioRxiv - Neuroscience 2019Quote: ... The T2A-GFP sequence was amplified by PCR using plasmid PX461 (a gift from Feng Zhang; Addgene plasmid #48140) as template and inserted into the intermediate plasmid at HindIII site to generate pAAV-hSyn-FLPo-T2A-GFP ...
-
bioRxiv - Synthetic Biology 2021Quote: ... multiple fragments were PCR amplified from different donor plasmids and assembled as follow: pMK232 CMV-OsTIR1-PURO (Addgene #7283433) was used as donor plasmid for the expression of OsTIR1 from the AAVS1 locus ...
-
bioRxiv - Cell Biology 2020Quote: The gRNAscaffHygroR vector was constructed by PCR amplification of the Hygromycin resistance gene from pBABE-hygro-hTERT (Addgene # 1773) plasmid and cloning into the EGFP_SV40PA vector downstream of the OmEF1a promoter followed by the modified guide RNA scaffold sequence PCR amplified from gRNA_GFP-T2 (Addgene # 41820).
-
bioRxiv - Neuroscience 2019Quote: GFP-progerin cDNA was PCR amplified from the pBABE-puro-GFP-progerin plasmid (Addgene, 17663 deposited by Tom Misteli) using primers (forward 5’-GATCATCGATATGGTGAGCAAGGGCGAGGAG-3’ ...
-
bioRxiv - Biochemistry 2020Quote: BsaI sites and compatible overhangs were added by PCR amplification of cpGFP from pTKEI-Mal-B2 (Addgene Plasmid #79756) using primers cpGFP-BsaI-GG-F and cpGFP-BsaI-GG-R ...
-
bioRxiv - Cell Biology 2021Quote: ... the open reading frames of mTagBFP2 and mNeongreen2 were amplified by PCR from donor vectors pBAD-mTagBFP2 (Addgene #34632) and pSFFV_mNG2(11)1-10 (Addgene #82610) ...
-
bioRxiv - Microbiology 2021Quote: ... the human ACE2 coding sequence (RefSeq accession NM_001371415.1) was PCR amplified and cloned into the BamHi site of lentiviral vector pHR-PGK (Addgene #79120). Lentivirus was produced as described above and used to transduce 5×104 target cells (A549 ...
-
bioRxiv - Systems Biology 2020Quote: ... and S415A) were introduced using the delitto perfetto method (Stuckey et al., 2011) using the PCR-amplified pCORE cassette (RRID:Addgene_72231) to integrate selective markers at the endogenous gene loci ...
-
bioRxiv - Cell Biology 2021Quote: ... mScarlet-i-H2A construct was amplified by PCR from pmScarlet-i_H2A_C1 (a gift from Dorus Gadella, Addgene plasmid #85053) (Bindels et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... the EB3-tdTomato fragment was amplified by PCR from EB3-tdTomato (a gift from Erik Dent, Addgene plasmid #50708) (Merriam et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... TVA-mCherry was amplified by PCR from a plasmid (gift from Dr. Uchida, Addgene plasmid #38044 ; http://n2t.net/addgene:38044 ; RRID:Addgene_38044, ref43) and inserted into a 5xUAS vector34.
-
bioRxiv - Developmental Biology 2022Quote: ... 100µl of the ESCs were then mixed with the scCRISPR construct (Composition: 10µl elute of HDR PCR product; 1µl sgPal7 (Addgene, 71484); 1µl spCas9-BlastR (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... NTR candidates were PCR amplified and cloned into the NdeI and SalI sites of two plasmids: pUCX (Addgene #60681), for biological overexpression assays ...
-
bioRxiv - Neuroscience 2022Quote: ... the DNA sequence encoding hPMCA2w/b was PCR amplified from pZac2.1-GfaABC1D-mCherry-hPMCA2w/b (a gift from Baljit Khakh (Addgene plasmid # 111568 ...
-
bioRxiv - Cell Biology 2019Quote: ... The enhanced green fluorescent protein (EGFP) sequence was amplified via PCR from a pcDNA3-EGFP plasmid that was a gift from Doug Golenbock (RRID:Addgene_13031). The EGFP sequence was cloned in-frame on the N-terminus of TMEM135 in the pTarget vector using BamHI and XhoI restriction enzymes ...
-
bioRxiv - Biochemistry 2021Quote: pGN002: The ECFP encoding fragment was amplified by PCR using primers GNCA005 and GNCA006 (on pcDNA3-CFP, Addgene #13030), followed by DpnI treatment ...
-
bioRxiv - Cell Biology 2019Quote: ... His-tagged SEPT5 plasmid was constructed by PCR amplifying SEPT5 from pCMV-Myc-tagged SEPT5 (Addgene plasmid # 27272; http://n2t.net/addgene:27272; RRID: Addgene_27272) (Amin et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... guide sequences were PCR amplified from a CustomArray Inc oligo pool and cloned into the lentiGuide-Puro (Addgene #52963) backbone using Golden Gate cloning ...
-
Using optogenetics to link myosin patterns to contractile cell behaviors during convergent extensionbioRxiv - Developmental Biology 2021Quote: ... and the cDNA of CRY2PHR was PCR amplified from the pCRY2PHR-mCherryN1 plasmid from the Tucker Lab (Addgene 26866) (7) ...
-
bioRxiv - Molecular Biology 2021Quote: Full-length and C-terminal truncated KDM6B cDNA was amplified by PCR from KDM6B plasmids (Addgene, #21212 and #21214) and subcloned into pLVX-Ubc-FLAG vector ...
-
bioRxiv - Biochemistry 2021Quote: A construct encoding residues 109-492 comprising soluble TMPRSS2 ectodomain was amplified by two PCR fragments (Addgene plasmid# 53887) and subcloned into the pFHMSP-LIC C donor plasmid by LIC method ...
-
bioRxiv - Microbiology 2020Quote: ... the human ACE2 gene (Miaolingbio #P5271) was PCR-amplified and cloned into the pLV-EF1a-IRES-blast (Addgene #85133). The human TMPRSS2 and DPP4 gene (Sino Biological #HG13070-CM ...
-
bioRxiv - Molecular Biology 2022Quote: ... Flag-hHOXA1 (pchHOXA1-3XFlag-myc) and Flag-mHoxA1 (pcmHoxa1-3XFlag-myc) were generated by cloning PCR-amplified inserts into a pcDNA3.1 vector (Addgene) featuring a 3XFlag-myc tag sequence in the multiple cloning site ...
-
bioRxiv - Biophysics 2022Quote: ... the DNA sequence encoding the T7 RNA polymerase promoter and sgRNA was amplified by PCR from pHelper_ShCAST_sgRNA vector (Addgene, #127921). The DNA template was then subjected to GeneJet PCR purification (ThermoScientific) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Histone H2A cDNA were PCR amplified from pCDNA3.1-Flag-H2A and pCDNA3.1-Flag-H2A K118-119R51 (Addgene, #63560, #63564). Histones Macro-H2A cDNAs were obtained for the DKFZ cDNA clone repository.
-
bioRxiv - Immunology 2022Quote: ... pTRIP-hPGK-STING-TurboID was cloned by Gibson assembly of PCR amplified TurboID from V5-TurboID-NES_pCDNA3 (Addgene #107169) and STING from pTRIP-CMV-STING-GFP ...
-
bioRxiv - Plant Biology 2022Quote: ... The LacZ selection marker was PCR amplified with flanking BsaI sites into Level 1 acceptor vector pICH41780 (Addgene #48019) to allow blue-white screening for successful gRNA insertion into final ABE vectors ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This fragment was subcloned with the above PCR fragment using Gibson enzymatic assembly (Gibson et al. 2009) to generate PRE-Hsp70BbCas9_1.0 (Addgene 190795). Gypsy insulator elements were subsequently cloned into PRE-Hsp70BbCas9_1.0 through two Gibson cloning events to generate PRE-Hsp70BbCas9_1.2 (Addgene 190796 ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR fragment was subcloned in the BamHI and NotI site of pET-28a+GFP-CAMSAP1 CKK (Addgene #59033), which contains 6 histidine (His ...
-
bioRxiv - Cancer Biology 2024Quote: The full-length human HK2 open reading frame (ORF) flanked by the linkers was amplified by PCR using plasmid FLHKII-pGFPN3 (RRID:Addgene_21920) as a template with primers (GGGTCCTGGTTCGATGATTGCCTCGCATCTGCTTGCCTACTTC and CTTGTTCGTGCTGTTTACTATCGCTGTCCAGCCTCACGGATGCGGC ...
-
bioRxiv - Developmental Biology 2024Quote: ... The resulting pU6-chiRNA cassette was amplified by PCR and inserted into the pnos-Cas9-nos plasmid (Addgene #62208) at the NheI restriction site ...
-
bioRxiv - Cell Biology 2024Quote: ... and mCherry ORFs were amplified by PCR using pFa6a-mEGFP-kanMX6 (a gift from Julien Berro72, Addgene plasmid # 87023), pAS1NB (a gift from Mark Prescott35 ...
-
bioRxiv - Biochemistry 2023Quote: ... This PCR product was digested with BamHI and BsrGI and cloned into pET-21a-PEmax-6His (Addgene plasmid #204471) digested with the same enzymes ...
-
bioRxiv - Molecular Biology 2023Quote: ... the dFMRP CDS was PCR amplified from pAc5.1-EGFP-dFMRP and transferred into pET-His6-MBP-TEV (Addgene #29656) by ligation-independent cloning following QB3 Macrolab protocols (https://qb3.berkeley.edu/facility/qb3-macrolab/) ...
-
bioRxiv - Genetics 2023Quote: ... GFP-3’UTR was PCR amplified using primers (5’-AGCTTGCATGCCTGCAGGTCG-3’ and 5’-AAGGGCCCGTACGGCCGACTA-3’) and plasmid pPD95.75 (Plasmid #1494-Addgene) as the template ...
-
bioRxiv - Molecular Biology 2023Quote: ... each of these systems was PCR amplified and cloned into pTNS2 to replace the parental mini-Tn7 (Addgene #64968) by Golden Gate assembly ...