Labshake search
Citations for Addgene :
701 - 750 of 2123 citations for Mouse EGF Like Repeat And Discoidin I Like Domain Containing Protein 3 EDIL3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... sgFLI_Ex9 (5’-GCCTCACGGCGTGCAGGAAG-3’) was cloned into lentiCRISPR v2-Blast vector (Addgene, #83480) using BsmbI restriction sites ...
-
bioRxiv - Cell Biology 2020Quote: ... pDD162 (Peft-3::Cas9 + Empty sgRNA) was a gift from Bob Goldstein (Addgene plasmid # 47549 ...
-
bioRxiv - Biophysics 2020Quote: ... and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907) with Lipofectamine 2000 according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... a p21 sgRNA (5’-GATTGCGATGCGCTCATGGC-3’) was cloned into the px330 vector (Addgene). ESCs were co-transfected with 2μg of this vector and 0,12μg of an hygromycin marker (#631625 ...
-
bioRxiv - Biochemistry 2021Quote: ... The pcDNA 3-CDK9 HA plasmid was purchased from Addgene (ID 14640, RRID:Addgene_14640), which was originally established by Dr Matija Peterlin (43) ...
-
bioRxiv - Biochemistry 2020Quote: pHA#843: hrp-1p∷hrp-1HsLCΔLC∷hrp-1 3’UTR (Addgene ID: 139200)
-
bioRxiv - Biochemistry 2020Quote: pHA#849: mec-4p∷hrp-1HsLCD290VmScarlet∷hrp-1 3’UTR (Addgene ID: 139203)
-
bioRxiv - Biochemistry 2020Quote: pHA#841: hrp-1p∷hrp-1HsLCWT∷hrp-1 3’UTR (Addgene ID: 139198)
-
bioRxiv - Biochemistry 2020Quote: pHA#848: mec-4p∷hrp-1HsLCWTmScarlet∷hrp-1 3’UTR (Addgene ID: 139202)
-
bioRxiv - Biochemistry 2020Quote: pHA#842: hrp-1p∷hrp-1HsLCD290V∷hrp-1 3’UTR (Addgene ID: 139199)
-
bioRxiv - Neuroscience 2022Quote: ... unique sgRNA (5’-CACCGGGACATAGTATTTGAAAGAC-3’) was cloned into lenti-CRISPRv2 construct (Addgene #52961), which expresses Cas9 and puromycin cassette ...
-
bioRxiv - Cell Biology 2020Quote: ... pDD162 (Peft-3::Cas9 + Empty sgRNA) was a gift from Bob Goldstein (Addgene plasmid # 47549 ...
-
bioRxiv - Cell Biology 2021Quote: ... the Cas9-expression plasmid pDD162 (Peft-3::Cas9, 50 ng/μL, Addgene #47549) (Dickinson et al. ...
-
bioRxiv - Biochemistry 2020Quote: pHA#847: mec-4p∷hrp-1mScarlet∷hrp-1 3’UTR (Addgene ID: 139201)
-
bioRxiv - Immunology 2021Quote: ... pLenti-GFP (Core with 5’ and 3’ LTR) was also from Addgene (#17448) and the plasmids containing Tat1b and Rev1b (SARS-Related Coronavirus 2 ...
-
bioRxiv - Genetics 2019Quote: ... pDD162 (Peft-3∷Cas9 + Empty sgRNA) 49 was purchased from Addgene (Plasmid #47549). A repair oligo containing mutated PAM and new bases inserted between the sgRNA sequence and PAM (5’-CATGCCAGATCGGAAATCGACATCGAGCCGGACGCGATTCGAAAAGAGGTGCGAAAGCTCCCGGGCTAGCTCGTCGAACGCCAACGCCATCGTCGAATCCACGTACAGCATGCCGGAG-3’ ...
-
bioRxiv - Genetics 2021Quote: ... and 3 μg of each paired TALEN targeting either AAVS1 or CLYBL (Addgene, 59025/59026 or 62196/62197 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Bot oligo – 5’-aaacTTGGCACTCCATTAGATCCG-3’) were cloned into U6.3>gRNA.f+e (#99139, Addgene) and electroporated at a concentration of 1.5 ug/ul ...
-
bioRxiv - Genetics 2023Quote: ... and a poly-A p-3’entry clone (Addgene, Kristen Kwan, Chien lab) were used.
-
A modular circuit architecture coordinates the diversification of courtship strategies in DrosophilabioRxiv - Neuroscience 2023Quote: ... and the p10-3’UTR PCR amplified from the plasmid pJFRC81 (Addgene #36432). These were then cloned by Gibson assembly (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-mDlx-ChR2-mCherry-Fishell-3 was a gift from Gordon Fishell (Addgene plasmid # 83898 ...
-
bioRxiv - Microbiology 2023Quote: S10-3 cells were transfected with the pSpCas9(BB)-2A-GFP (Addgene #48138) plasmid encoding the Cas 9 protein fused to GFP by the 2A peptide ...
-
bioRxiv - Cancer Biology 2023Quote: ... 14-3-3ζ was subcloned into pmTurquoise2-N1 (Addgene, Massachusetts, USA; plasmid # 54843) using restriction enzymes EcoRI (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... we bilaterally injected with RetroAAV-hSyn-Cre (500nL, Addgene Lot v70508, 3*1013) into the LS ...
-
bioRxiv - Neuroscience 2024Quote: ... 750 nl of the retroAAV-hsyn-Cre (500nL, Addgene Lot v70508, 3*1013) was injected in the VTA of male and female C57/BL6 mice ...
-
bioRxiv - Synthetic Biology 2022Quote: ... MoClo Plant Parts Kit (Addgene Kit #1000000047), GreenGate Cloning System (Addgene Kit #1000000036 ...
-
bioRxiv - Molecular Biology 2021Quote: ... GFP ORF was PCR-amplified and cloned between AgeI and EcoRI sited of lentiviral vector with synapsin I promoter (Addgene #20945). During this cloning AgeI site was destroyed and a new AgeI was introduced on a PCR primer downstream of GFP ...
-
bioRxiv - Molecular Biology 2020Quote: ... an oligo duplex encoding the sgRNA sequence was cloned at the Bbs I site of pX458-pSpCas9 (BB)-2A-GFP plasmid (Addgene #48138). To construct a donor vector ...
-
bioRxiv - Bioengineering 2020Quote: The following sequence for the I-Adα.TCRα chimeric CRMpMHCIIα subunit was subcloned into the pMSCV-ires-CFP II (gift from Dario Vignali, Addgene plasmid # 52109) via 5’EcoRI and 3’XhoI: gaattccgccaccatgccgtgcagcagagctctgattctgggggtcctcgccctgaacaccatgctcagcctctgcggaggtgaagacgacattgaggccgaccacgtaggcttctatggtacaactgtttatcagtctcctggagacattggccagtacacacatgaatttgatggtgatgagttgttctatgtggacttggataagaagaaaactgtctggaggcttcctgagtttggccaattgatactctttgagccccaaggtggactgcaaaacatagctgcagaaaaacacaacttgggaatcttgactaagaggtcaaatttcaccccagctaccaatgaggctcctcaagcgactgtgttccccaagtcccctgtgctgctgggtcagcccaacacccttatctgctttgtggacaacatcttcccacctgtgatcaacatcacatggctcagaaatagcaagtcagtcacagacggcgtttatgagaccagcttcctcgtcaaccgtgaccattccttccacaagctgtcttatctcaccttcatcccttctgatgatgacatttatgactgcaaggtggagcactggggcctggaggagccggttctgaaacactgggaacctgagattccagcccccatgtcagagctgacagaaactgtgtgtgatgccacgttgaccgagaaaagctttgaaacagatatgaacctaaactttcaaaacctgtcagttatgggactccgaatcctcctgctgaaagtagcgggatttaacctgctcatgacgctgaggctgtggtccagttgactcgag
-
bioRxiv - Developmental Biology 2019Quote: Ubi-SpCas9::P2A::mPicota::T2A::mCitr(#1)trine-polyA-U6c-gRN(#7)NA#1: we used multisite-Gateway cloning to recombine: i) a p5E ubi vector (34, Addgene #27320), ii ...
-
bioRxiv - Molecular Biology 2023Quote: Plasmids for type I-F CASTs Cascade over-expression were constructed by sub-cloning the individual genes into pRSFDuet1 (Addgene #126878) to create pIF1008 ...
-
bioRxiv - Cell Biology 2023Quote: ... This phosphorylated DNA fragment was ligated to the Bbs I cloning site in pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid # 62988) [16] ...
-
bioRxiv - Cancer Biology 2023Quote: ... the I-SceI-P2A-mCherry plasmid which we generated by replacing AmCyan with I-SceI in the bicistronic plasmid Amcyan-P2A-mCherry (Addgene #45350) was delivered by nucleofection after 24 hours ...
-
bioRxiv - Neuroscience 2024Quote: pAAV CAG-FLEx-FLPo was constructed by in-fusion-based PCR cloning utilizing the following two DNA fragments: i) SalI-AscI restriction fragment of pAAV CAG-FLEx-TCb (Addgene #48332) as a vector backbone ...
-
bioRxiv - Cell Biology 2023Quote: ... and mito-PDCD10-mScarlet-I (mito-PDCD10) constructs were created by inserting a custom gene block (IDT) in the pMTS-mScarlet-I-N1 plasmid (Addgene 85059) using the XhoI/EcoRI sites ...
-
bioRxiv - Cell Biology 2022Quote: ... and mCherry-Snx9 (#27678) (all mouse) were from Addgene.
-
bioRxiv - Neuroscience 2020Quote: ... Postsynaptic mouse neuroligin-1 was PCR amplified from Addgene #15260 ...
-
bioRxiv - Biophysics 2023Quote: ... mouse Opa1 sequence was cloned into pR26-CMVconst (Addgene plasmid #127373 ...
-
bioRxiv - Genetics 2024Quote: Mouse CRISPR Brie lentiviral pooled library (Addgene Plasmid # 170511) consisting of 79,637 gRNAs was co-transfected with packaging plasmids (psPAX2 and pMD2.G ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were transfected with plasmids containing the packaging psPAX2 (Addgene, 12260, from Didier Trono) and envelope pCMV-VSV-G (Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... The cell line carrying the 5’TOP element-containing SunTag reporter (Addgene plasmid #119946) together with scFv-GFP and NLS-stdMCP-stdHalo was described previously (Wilbertz et al. ...
-
bioRxiv - Immunology 2021Quote: ... were subcloned into the lentiviral pLKO.3G vector containing an eGFP cassette (Addgene #14748), by transferring the BamHI-NdeI restriction fragments containing the shRNAs ...
-
bioRxiv - Molecular Biology 2022Quote: Separate lentivectors containing spCas9 (lentiCas9-Blast a gift from Feng Zhang (Addgene plasmid # 52962) and sgRNA (lentiGuide-Puro a gift from Feng Zhang (Addgene plasmid # 52963 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and lentiviral particles from pLenti6.3/TO/V5 containing IDH1R132H,13 or pLentiCRISPRv2 (Addgene #52961) were produced in 293T cells as previously described18 ...
-
bioRxiv - Genomics 2022Quote: Plasmids containing dCas9-VPR (SP-dCas9-VPR was a gift from George Church (Addgene plasmid # 63798 ...
-
bioRxiv - Genomics 2020Quote: SpCas9 gRNAs were cloned into a Tol2-transposon-containing gRNA expression plasmid (Addgene 71485) 59. ...
-
bioRxiv - Molecular Biology 2020Quote: ... The Cre-containing plasmid was obtained from Addgene (pLM-CMV-R-Cre, Addgene #27546). A fragment encoding the CMV promoter and mCherry-T2A-Cre-WPRE was excised by NdeI and SacII (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... a transfer plasmid containing rat Synapsin promoter and cDNA encoding GCaMP6s (Addgene plasmid #40753) was assembled and transfected with helper-free DJ plasmids (Cell Biolabs ...
-
bioRxiv - Biophysics 2021Quote: ... Plasmid containing RelA or p50 was co-transformed with pEVOL-pAzF (Plasmid #31186, Addgene), the plasmid encoding the aaRS/tRNA pair for incorporating the unnatural amino acid p-azidophenylalanine (pAzF ...
-
bioRxiv - Microbiology 2021Quote: ... SpyCatcher/Spy-tag and SUMO containing plasmids were purchased from Addgene (#133449 and #111560).