Labshake search
Citations for Addgene :
951 - 1000 of 2123 citations for Mouse EGF Like Repeat And Discoidin I Like Domain Containing Protein 3 EDIL3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... 5 µg of sgRNA plasmid library was co-transfected with 3 µg of psPAX (Addgene, 12260) and 1 µg of pMD2.G (Addgene ...
-
bioRxiv - Genomics 2021Quote: We used PCR to add V5 epitope tags to the 3’ end of FoxA1 (Addgene #120438) and Hnf4a (Addgene #120450 ...
-
bioRxiv - Cancer Biology 2022Quote: ... PC-3 HRE luciferase cells were generated by co-transfection of 3xHRE-luciferase construct (Addgene 26371) with a puromycin-resistant construct ...
-
bioRxiv - Neuroscience 2022Quote: [3] ie1: An enhancer/promoter from pGL3-IE1 (a gift from Zach Adelman, Addgene ID #52894) (Anderson et al. ...
-
Improving the efficacy and accessibility of intracranial viral vector delivery in non-human primatesbioRxiv - Neuroscience 2022Quote: ... Subjects MTL1-3 were infused with two retrograde viruses (gifted from Edward Boyden & Karel Svoboda; Addgene viral preps #59170-AAVrg & #29017-AAVrg ...
-
bioRxiv - Molecular Biology 2023Quote: ... The DNMT1-targeting sgRNA (5′-GGCGGTACGCGCCGGCATCT –3′) was cloned into pX330 hSpCas9 expressing vector (Addgene #42230) and verified by sequencing.
-
bioRxiv - Cell Biology 2023Quote: ... and (3) GFP1-10 from pFA6a-link-yGFP1-10-CaURA3MX (Addgene 86419; (Smoyer et al., 2016)) and subsequent cloning into the XhoI/NotI sites of pRS304 mito-DsRed.
-
bioRxiv - Molecular Biology 2023Quote: shRNA sequence targeting TAL1 3’UTR (CATAACCACTGAAGGGAAT) was cloned to Tet-pLKO-puro vector (Addgene #8453). For lentivirus production ...
-
bioRxiv - Synthetic Biology 2023Quote: ... pNO286-3 (a gift from Jeffrey Tabor, Addgene plasmid # 107746; http://n2t.net/addgene:107746; RRID:Addgene 107746) [32] ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNAs corresponding to 3’ to the region of interest was cloned in pDecko-mCherry (Addgene, #78534). The puromycin resistance cassette in pLentiCRISPRv2 was replaced by a GFP gene using standard cloning techniques ...
-
bioRxiv - Developmental Biology 2023Quote: ... The three fragments were subcloned into pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957) by replacing T2A-Gal4 with T2A-GAL4DBD ...
-
bioRxiv - Developmental Biology 2023Quote: ... The three fragments were subcloned into pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957) by replacing T2A-Gal4 with T2A-VP16 ...
-
bioRxiv - Cell Biology 2023Quote: ... Both pie-1p and pie-1 3’UTR PCR products were amplified using pPK605 plasmid (Addgene) as the template.
-
bioRxiv - Neuroscience 2023Quote: ... 0.3 μl of AAV2/9-CAG-ChR2-mCherry (3 × 1012 genomic copies per mL, Addgene, 100054) or AAV2/9-CAG-mCherry (2.85 × 1012 genomic copies per mL ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV.CamKII(1.3).eYFP.WPRE.hGH was a gift from Karl Deisseroth (Addgene plasmid# 105622; http://n2t.net/addgene:105622; RRID:Addgene_105622).
-
bioRxiv - Molecular Biology 2023Quote: ... with 3 million K562 cells and 10 µg of pCMV-PE2-tagRFP-BleoR (Addgene no. 192508) per individual electroporation (Day 0) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 293FT cells were co-transfected using (per condition) 3 µg of pLKO.GFP transfer plasmid (Addgene, #30323) containing the shRNA (sequences in Supplementary Table S6) ...
-
bioRxiv - Biochemistry 2024Quote: ... human PLD3 sgRNA (5′-3′) was cloned into pSpCa9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988) as described (Ran et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... or human Mon1b (5’-GATGTGCAGATGGAGGTCGG-3’) were cloned into pSpCas9(BB)-2A-Puro (PX459) (Addgene #48139). The donor constructs used for homologous recombination were generated by cloning into the pUC19 vector with two ∼600-800-nucleotide fragments of genomic DNA upstream and downstream of the start codon of human USP8 ...
-
bioRxiv - Biochemistry 2019Quote: ... with Protein kinase A (M. musculus PKA catalytic subunit alpha; Addgene 14921) expressed with an N-terminal His tag ...
-
bioRxiv - Biophysics 2021Quote: ... This vector also contains EF1α promoter for target protein expression (Addgene #65712) and puromycin resistance gene under PGK promoter for antibiotic selection of the transferred cells ...
-
bioRxiv - Cell Biology 2021Quote: ... The plasmids coding for the following protein products were obtained from Addgene: non-fluorescent FRB-ECFP(W66A)-Giantin [# 67903 ...
-
bioRxiv - Cell Biology 2019Quote: ... RCC1 was targeted with an infra-red fluorescent protein (IFP2.0 Addgene #54785), TIR1 was targeted with 9 Myc-tag sequences ...
-
bioRxiv - Biochemistry 2020Quote: ... Membrane scaffold protein 1D1 (MSP1D1) was expressed from the pMSP1D1 plasmid (AddGene) with an N-terminal His-tag and was purified by affinity chromatography (26).
-
bioRxiv - Biochemistry 2021Quote: ... The plasmid encoding for membrane scaffold protein MSP1D1 was purchased from AddGene.43
-
bioRxiv - Genomics 2020Quote: Tn5 was generated by the MDC Protein Production & Characterization Platform from Addgene plasmid #60240 according to76 at 1.95 mg/ml with the following minor modifications ...
-
bioRxiv - Molecular Biology 2020Quote: Protein expression constructs were obtained through the following: FLAG-N1ICD (AddGene #20183), N2ICD (#20184) ...
-
bioRxiv - Molecular Biology 2022Quote: For validation experiments we introduced the fluorescent protein EBFP2 (source: Addgene 54665) driven by the dpse enhancer and the CG13116 promoter in the RD-seq plasmid backbone to be able to gate for transfected cells in flow cytometry (Suppl ...
-
bioRxiv - Cell Biology 2022Quote: ... For LRP6 and ADAMTSL2 protein interaction studies the LRP6-pCS2 (Addgene, 27242) was used for co-transfection ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids expressing the SARS-CoV-2 S protein were obtained from Addgene: pcDNA3.3-SARS2-B.1.617.2 (Delta ...
-
bioRxiv - Immunology 2023Quote: ... 700 ng/mL of Protein A/G-MNase (plasmid Addgene ID:123461) were added to the immunocomplexes ...
-
bioRxiv - Neuroscience 2024Quote: Enhanced green fluorescent protein (EGFP) plasmid (pEGFP-C1) was commercially purchased (Addgene). The fluorescent protein mKate was inserted into a pcDNA3.1(- ...
-
Efficient CRISPR/Cas9 genome editing in a salmonid fish cell line using a lentivirus delivery systembioRxiv - Genetics 2019Quote: ... Specific gRNA for EGFP and RIG-I (Table2, underlined) were cloned according to Golden Gate reaction from ZhangLab protocol (Addgene SAM library sgRNA cloning protocol) using BbsI-HF (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... A lentivirus construct containing the biotin ligase BirA was generated from the lentiCRISPR v2 backbone (Addgene 52961)[61] and a construct containing BirA (a gift from Mauro Modesti ...
-
bioRxiv - Molecular Biology 2019Quote: A DNA fragment containing GA50 was amplified from pAG303-Gal-GA50 (Addgene # 84907; (Jovičič et al., 2015)) and a DNA fragment containing GFP were inserted into pCAGEN by NEBuilder HiFi DNA Assembly Master Mix (NEB).
-
bioRxiv - Immunology 2019Quote: ... GXMR-CAR containing the lentiviral vectors pMD2.G (VSV-G envelope-expressing plasmid; Addgene; cat. no. 12259) and psPAX2 (second-generation lentiviral packaging plasmid ...
-
bioRxiv - Microbiology 2019Quote: Oligos containing sgRNA sequence were annealed and ligated into pX458 (gift from Feng Zhang; Addgene plasmid # 48138). Cells were transfected with pX458 using Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Genomics 2019Quote: ... and to a plasmid containing the Oct4:EGFP transgene (GOF18ΔPE EGFP, Addgene plasmid #52382; http://n2t.net/addgene:52382; RRID:Addgene_52382).
-
bioRxiv - Synthetic Biology 2020Quote: ... targeting the LMNB1 gene (GGGGTCGCAGTCGCCATGGC) (2 ug) and an LMNB1-mEGFP containing repair vector (Addgene plasmid #87422) (3 μg ...
-
bioRxiv - Bioengineering 2019Quote: GV-expressing cells were produced by transforming a pET28a plasmid containing the arg1 gene cluster12 (Addgene #106473) into BL21(A1 ...
-
bioRxiv - Neuroscience 2021Quote: ... The GFP coding region containing artificial introns was PCR-amplified from the vector pPD95.69 (Addgene plasmid #1491) using primers to add segments encoding SGGGGS and SGGGTS to flank the N- and C-termini of GFP ...
-
bioRxiv - Biochemistry 2020Quote: ... and Gibson-assembled into a pHR vector containing a C-terminal mCherry-CAAX fusion tag (Addgene #50839). Stellar E ...
-
Mediobasal hypothalamic FKBP51 acts as a molecular switch linking autophagy to whole-body metabolismbioRxiv - Neuroscience 2021Quote: ... A viral vector containing a Cre expressing cassette (pAAV-CMV-HI-eGFP-Cre-WPRE-SV40, Addgene; #105545) was used to induce Fkbp5 deletion in Fkbp5lox/lox mice ...
-
bioRxiv - Cancer Biology 2020Quote: The vector containing RON (MST1R) pDONR223-MST1R was a gift from William Hahn and David Root (Addgene plasmid # 23942 ...
-
bioRxiv - Biophysics 2020Quote: ... Two plasmids containing full-length untagged Npl4 and C-terminal His-tagged Ufd1 were purchased from Addgene. Npl4 fragments were expressed in pET-28a vector with an N-terminal His-SUMO tag ...
-
bioRxiv - Molecular Biology 2022Quote: ... The resulting DNA fragment containing two MpU6promoter-gRNA cassettes was transferred into pMpGE010 (cat. no. 71536, Addgene) (Sugano et al. ...
-
bioRxiv - Genetics 2021Quote: ... Constructs containing different sgRNAs (500 ng) were co-transfected with pCMV-ABE7.10 (2000 ng, Addgene plasmid # 102919) into cells by using LipofectamineTM 3000 (Thermo Fishers ...
-
bioRxiv - Neuroscience 2021Quote: ... we co-transfected neurofilament medium chain (NFM) cDNA-containing plasmid pmNFM (a gift from Anthony Brown, Addgene plasmid #83126 ...
-
bioRxiv - Cancer Biology 2020Quote: ... or vector containing the dominant negative TP53 construct (pBABE-hygro p53 DD, Bob Weinberg, Addgene plasmid #9058) into the clonal MCF10-2A TetOn-CENPA-FLAG-HA cell line by lentiviral transduction ...
-
bioRxiv - Genomics 2021Quote: ... Early passage primary MEFs were transformed with SV-40 T antigen containing plasmid pBSSVD2005 (ADDGENE, Cambridge, MA) to generate immortalized MEFs ...