Labshake search
Citations for Addgene :
851 - 900 of 2123 citations for Mouse EGF Like Repeat And Discoidin I Like Domain Containing Protein 3 EDIL3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... and the DAG maker C1δ-GFP amplified from rat PKCδ C1-containing plasmid (Addgene #21216) 61 was expressed from ura4 locus under scs2 promoter ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.4 μl of AAV solution containing pZac2.1 gfaABC1D-cyto-GCaMP6f (Addgene viral prep # 52925-AAV5) was injected at 50 nL/min using a hydraulic injection apparatus driven by a syringe pump (UltraMicroPump ...
-
bioRxiv - Neuroscience 2023Quote: ... the pipette containing AAVPHP.S-CAG-FLEX-tdTomato virus (Addgene 28306-PHP.S, 1.8×1013 vg/mL) targeted at 2 locations in the mandibular branch spaced 250 um apart ...
-
bioRxiv - Genetics 2023Quote: ... 5 µl of a solution containing a Cre-GFP plasmid (∼2 µg/µl, Addgene #13776) and phenol red (0.1% Sigma #P0290 ...
-
bioRxiv - Systems Biology 2023Quote: Lentiviral particles containing pLentiPGK-Hygro-DEST-H2B-mCerulean3 (kind gift from Markus Covert44; Addgene: 90234) vector were produced in HEK293T (ATCC ...
-
bioRxiv - Cell Biology 2023Quote: ... pTGL0386 containing KRAB and dCas9 for CRISPRi (a gift from Jorge Ferrer, Addgene plasmid #118154); pCRISPRi0001 containing gRNA 5’ GTGCTAAAGGAGCCCGGCGG 3’ cloned into pTGL0386 ...
-
bioRxiv - Cell Biology 2023Quote: ... sgRNA guides were cloned into lentiCRISPR-V2 plasmids containing the puromycin resistance vector (Addgene, 98290), transformed into Stbl3 competent E ...
-
bioRxiv - Cell Biology 2023Quote: Each gRNA was cloned into a plasmid containing spCas9 and EGFP sequences (PX458; Addgene 48138) (Ran et al. ...
-
bioRxiv - Systems Biology 2024Quote: ... pPBbsr-JNKKTR-mCherry plasmid containing JNK activity reporter (JNK-KTR) was obtained from Addgene (#115493). mCherry in this plasmid was exchanged with iRFP713 (from Addgene #111510 ...
-
bioRxiv - Cell Biology 2023Quote: ... miniTurbo containing plasmid 3xHA-miniTurbo-NLS_pCDNA3 was a gift from Alice Ting (Addgene plasmid # 107172). miniTurbo gene (primers ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplicons containing spacer sequences for two sgRNAs were generated from plasmid pCFD6 (Addgene 73915) using primers sgRNAampfwd ...
-
bioRxiv - Cell Biology 2020Quote: ... The pSIN-3×flag-ATF3 vector was derived from pSin-EF2-Nanog-Pur (#16578, Addgene). HEK293T cells were seeded so that cells density could be 80% confluence when it comes to transiently transfection ...
-
bioRxiv - Neuroscience 2020Quote: ... with 3 µg of the episomal plasmid mix (equimolar mixture of plasmids obtained from Addgene: pCE-hOct3/4 ...
-
bioRxiv - Neuroscience 2022Quote: ... (4) P10-3’UTR was amplified from pJFRC81-10XUAS-IVS-Syn21-GFP-p10 (Addgene 36432); (5 ...
-
bioRxiv - Cell Biology 2022Quote: ... gRNA (5’ - TTACTGCTCATCCTTGTCCT-3’) was cloned into pCFD5 vector (Port et al., 2014) (Addgene #73914) and then the resulting vector was injected into attP2 site (BDSC #25710) ...
-
bioRxiv - Genetics 2019Quote: ... the scaffold DNA sequence was amplified from pDD162 (Peft-3::Cas9 + dpy-10 sgRNA - Addgene plasmid # 47549 ...
-
bioRxiv - Pathology 2019Quote: ... gRNA_ex93.0: 5’-GCGTGAGGACAACCGCGTGCAGG-3’) were cloned into the pSPCas9(BB)-2A-GFP plasmid (Addgene 48138) and introduced into CRL1502 iPSCs by reverse transfection using TransIT-LT1 (Mirus Bio) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Rev 5’-AAAGCTAGCTCAGGTTGCCTGGTCCAG-3’ and cloned into the pCI H2B-RFP vector (Addgene plasmid #92398). For CRISPR/Cas9 targeting ...
-
bioRxiv - Neuroscience 2022Quote: ... The original CIRTs-6: B-defensin 3-TBP6.7-YTHDF2 plasmid (# 132544) was purchased from Addgene and the YTHDF2 domain was PCR amplified and cloned into the AgeI and NheI sites ...
-
bioRxiv - Neuroscience 2023Quote: ... HEK293T cells were co-transfected with 3 plasmids: pAd-DELTA F6 (plasmid No. 112867; Addgene), serotype plasmid AAV PHP.eB ...
-
bioRxiv - Plant Biology 2023Quote: ... and 3′ UTR and terminator sequences from Agrobacterium tumefaciens nopaline synthase (AtuNOST) (pICH41421, Addgene #50339). As a batch calibrator ...
-
bioRxiv - Cancer Biology 2023Quote: ... The ITGB3 sequence (pcDNA3.1-beta-3 was a gift from Timothy Springer; Addgene plasmid # 27289) was subcloned into pLenti6.3/TO/V5-Blasti (A11144 ...
-
bioRxiv - Cell Biology 2023Quote: ... the gRNA sequence 5’-AATGAGGCCTTGGAACTCA-3 was cloned into the Px330 vector (Addgene plasmid #42230) and transfected into cells using Lipofectamine Stem according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... encoding the Luc mRNA with the SARS-CoV-2 packaging signal in 3’-UTR (Addgene), were co-transfected with plasmids expressing the SARS-CoV-2 nucleocapsid (nCoV-2-N) ...
-
bioRxiv - Genetics 2023Quote: ... and 3’ extension oligos were cloned into the BsaI-digested pU6-pegRNA-GG- (Addgene #132777), pU6-tevopreQ1-GG- (Addgene #174038 ...
-
bioRxiv - Immunology 2023Quote: ... and a non-targeting control (5’-CACCGGTATAATACACCGCGCTAC-3’) were cloned into the lentiCRISPRv2 vector (Addgene). The gRNA construct was then co-transfected with two packaging plasmids (pMD2.G and pSPAX2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... SgRNA targeting EGFR (5’-CGATCTCCACATCCTGCCGG-3’) was cloned into the lentiGuide-puro vector (Addgene, USA) (18) ...
-
bioRxiv - Neuroscience 2023Quote: Unilateral stereotaxic injections of AAV5-CaMKIIα-EGFP (Addgene #50469; virus titer ≥ 3×10¹² vg/mL) and AAV5-hSyn-DIO-hM4D(Gi)-mCherry (Addgene #44362 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5’-AAACCCTTATTCGTACGTGGCT-3’) foxl2l#1 and foxl2l#2 fragments were cloned into pT7-gRNA (Addgene) through one-step digestion and ligation respectively ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5′-GGCTGCCGTAGCGCGACGTG-3′) were cloned into pLentiCRISPRv2 (Addgene-52961). An NT gRNA (5′-GTATTACTGATATTGGTGGG-3′ ...
-
bioRxiv - Neuroscience 2023Quote: ... The amplicons were inserted into the pCMV-Tag-2b or pGEX-5X-3 vector (Addgene). Spastin mutants were generated using the Quickchange Kit (Agilent ...
-
bioRxiv - Molecular Biology 2021Quote: SARS-CoV-2 viral proteins were amplified via PCR from Addgene constructs with a 1x (GGGS ...
-
bioRxiv - Cell Biology 2019Quote: ... Plasmids for nanobody fusion protein expression are deposited with Addgene (Addgene: #109417 ...
-
bioRxiv - Genetics 2020Quote: ... R47H TREM2 or GFP proteins (Addgene; pCW57-GFP-2A-MCS, #71783). After 2-weeks of puromycin selection ...
-
bioRxiv - Cell Biology 2021Quote: Protein expression vector pET28a-mCherry-CNA35 was obtained from Addgene (#61607). Transformed E.coli (BL21 ...
-
bioRxiv - Bioengineering 2022Quote: ... a stimulatory G-protein coupled receptor (custom made Chemogenetics AAV: Addgene). Clozapine-N-oxide (CNO ...
-
bioRxiv - Neuroscience 2021Quote: ... The fusion protein was cloned into pAAV-CAG-GFP (Addgene #37825) by substituting the GFP with H2B- mGreenLantern using restriction enzymes BamHI and XhoI ...
-
bioRxiv - Bioengineering 2020Quote: Yellow fluorescence protein (pLEX_970_puro_DEST_YFP gifted by William Hahn (Addgene plasmid # 45295)) and mCherry (plv_mCherry gifted by Pantelis Tsoulfas ...
-
bioRxiv - Cancer Biology 2019Quote: ... Bcl-2 proteins and their mutants (pMIG-Bcl-xL from Addgene, pMIG-BCL2 [6] ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and a C’-terminal yellow fluorescent protein (YFP; pICSL50005, Addgene #117536), and AtuOCS terminator ...
-
bioRxiv - Genomics 2021Quote: ... and Protein AG (pAG) was amplified from pAG/MNase (ASP4154, Addgene plasmid #123461 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids encoding RT proteins used in OTTR are available from AddGene: 2Bc-T MBP_BoMoC(ed)_6xH (JumpPol ...
-
bioRxiv - Biochemistry 2023Quote: ... The pCMV-PE2 plasmid expressing PE2 Cas9-RT fusion protein (Addgene plasmid #132775 ...
-
bioRxiv - Neuroscience 2023Quote: ... Fusion protein ProteinA-Tn5 was prepared in-house (plasmid Addgene #124601) by following a previously described protocol 33 ...
-
bioRxiv - Neuroscience 2024Quote: ... The chimeric Gqi9 protein was ordered from Addgene (Plasmid No. 125711). This was then further modified using PCR and cloned into the pcDNA3.1(+ ...
-
bioRxiv - Biochemistry 2024Quote: Biotinylated proteins were co-expressed with BirA (PET21a-BirA, Addgene #20857) in E ...
-
bioRxiv - Systems Biology 2022Quote: ... and lambda phosphatase were purchased from Addgene (Addgene Kit #1000000094)7.
-
bioRxiv - Genomics 2019Quote: ... from mouse tail genomic DNA and pX330 plasmid (Cat. 42230, Addgene), respectively ...
-
bioRxiv - Cancer Biology 2022Quote: Guides were quantified against the Yusa Mouse V2 library (Addgene #67988) using crisprReadCounts v1.3.1 (https://github.com/cancerit/crisprReadCounts) ...
-
bioRxiv - Neuroscience 2020Quote: ... Mouse nAChR alpha4 CFP was a gift from Henry Lester (Addgene plasmid # 15244 ...