Labshake search
Citations for Addgene :
551 - 600 of 2123 citations for Mouse EGF Like Repeat And Discoidin I Like Domain Containing Protein 3 EDIL3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... envelope protein-pCMV-VSV-G (Addgene #8454), packaging plasmid - pCMV-dR8.2 dvpr (Addgene #8455 ...
-
bioRxiv - Genomics 2021Quote: Plasmid pCBASceI for I-SceI expression and plasmid pcDNA3.1-mCherry were obtained from Addgene (#26477 and #128744 respectively). Guide RNAs TGCGACATAGTAGGGATAAC (gRNA1 ...
-
bioRxiv - Neuroscience 2020Quote: ... mScarlet-i cDNA was amplified by PCR from a pmScarlet-i_C1 plasmid (gift from Dorus Gadella, Addgene #85044) (Bindels et al. ...
-
bioRxiv - Molecular Biology 2023Quote: Lentiviral constructs coding for TLR (#31482) and I-SceI with donor e-GFP (#31476) were purchased from Addgene. To avoid the confounding effect of NHEJ on the repair of I-SceI-induced DNA breaks ...
-
bioRxiv - Biophysics 2020Quote: ... containing N-terminal 6-His-WT-p53 (1-303) (Addgene, 24859), was used to express p53 ...
-
bioRxiv - Cell Biology 2020Quote: A plasmid containing the hTERT sequence (#1773, Addgene, Watertown, MA, USA) was modified to contain the coding sequence for the human BMI1 followed by a P2A sequence ...
-
bioRxiv - Microbiology 2020Quote: ... 90 ug of pMDLg/pRRE packaging plasmid (containing Gag & Pol, Addgene), 36 ug of pRSV-Rev packaging plasmid (containing Rev ...
-
bioRxiv - Developmental Biology 2020Quote: ... A control PLKO.1 vector containing a scrambled shRNA (Addgene 1864) was used as a control ...
-
bioRxiv - Developmental Biology 2020Quote: Plasmids containing the coding sequence (CDS) for mCitrine-Lifeact (Addgene #54733), which labels filamentous actin (F-actin) ...
-
bioRxiv - Molecular Biology 2021Quote: ... coli cells containing the plasmid pCAS were obtained from Addgene (#60847). Plasmid pCAS (8.7 Kb ...
-
bioRxiv - Cell Biology 2019Quote: ... PX458 or PX458 containing gRNA and PLKO.1-puro (Addgene, #10878), were co-transfected into MEFs ...
-
bioRxiv - Cell Biology 2021Quote: ... containing equimolar amounts of transactivator donor (pAAVS1-Neo- M2rtTA, Addgene # 60843) + pCyto-roGFP2-Orp1-donor or pMito-roGFP2-Orp1-donor ...
-
bioRxiv - Biophysics 2021Quote: ... the pet28 plasmid containing His6 SARS-CoV-2 nsp13 (Addgene #159390) was transformed into E ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR fragments obtained from TurboID-containing plasmid (V5-TbID-NES_pCDNA3, Addgene) and pEarleyGate101 vector were assembled by overlapping ends using Gibson assembly master mix (NEB ...
-
bioRxiv - Genomics 2022Quote: ... 1 mL of overnight culture containing pTXB1-Tn5 (Addgene plasmid #60240) was used to inoculate 1 L of ZYM-505 growth media containing 100 μg/mL ampicillin and 0.001% polypropylene glycol (L14699-AE ...
-
bioRxiv - Molecular Biology 2022Quote: ... U6 promoter containing plasmid pSpCas9(BB)-2A-GFP (PX458) (Addgene, #48138) was digested with the BbsI and PvuI and run on 1% agarose gel ...
-
bioRxiv - Cell Biology 2022Quote: Plasmid p426MET25 containing sfpHluorin gene was purchased from Addgene (ID 115697). We swapped the yeGFP gene in pYM25 plasmid for sfpHluorin ...
-
bioRxiv - Biochemistry 2022Quote: Monomeric EGFP was subcloned into vectors containing human AR (Addgene #29235) and AR-V7 (Addgene #86856 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... wells were infected with lentivirus containing dCAS9-VP64_Blast (Addgene Plasmid #61425) and sgRNA targeting 2xHAR.183 ...
-
bioRxiv - Cell Biology 2023Quote: ... U2OS cells were transduced with virus containing lentiCas9-Blast (Addgene, #52962). Cells were then treated with 5 µg/mL blasticidin for 5 days to make a stable population of U2OS-Cas9 cells ...
-
bioRxiv - Cell Biology 2023Quote: Plasmid containing CDS sequences of human MCU were taken from Addgene and restriction digestion was performed ...
-
bioRxiv - Microbiology 2023Quote: ... containing either 1000 ng empty vector (EV) (Addgene plasmid # 10841 (108)) ...
-
bioRxiv - Cancer Biology 2023Quote: ... shCtrl-1 (negative control vector containing a nonhairpin insert Addgene #1864) and shCtrl-2 (MISSION® pLKO.1-puro non-mammalian shRNA Control Plasmid DNA ...
-
bioRxiv - Cancer Biology 2023Quote: PB-UniSAM containing mCherry was a gift from Lesley Forrester (Addgene plasmid # 99866 ...
-
bioRxiv - Biophysics 2023Quote: ... a pCDFDuet-1 plasmid containing His6-PPX-nsp7/8 (Addgene: 159092) was transformed into E ...
-
bioRxiv - Neuroscience 2023Quote: ... we used pKLO.1 containing a non-targeting sequence (Addgene #1864) (Sarbassov et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... we generated derivatives of pCFD5:U6:3-t::gRNA (Addgene, #73914). A first derivative (pCFD5:U6:3-t::gRNA_pst-1 ...
-
bioRxiv - Genetics 2021Quote: Calu-3 cells were transduced with lenti Cas9-Blast (Addgene #52962), or with lenti dCAS-VP64_Blast (Addgene #61425) ...
-
bioRxiv - Neuroscience 2022Quote: ... a 3:1 mixture of AAV-CAG-Flex-oG (Addgene #74292) and ΔG-Rab-GFP was injected into either the GS or TA muscles of P1-P2 pups ...
-
bioRxiv - Cancer Biology 2021Quote: pcDNA3.1-Myoferlin-HA and peGFP-hGalectin-3 was purchased from Addgene (plasmid no ...
-
bioRxiv - Neuroscience 2023Quote: ... and pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957) were gifts from Benjamin H ...
-
bioRxiv - Genetics 2023Quote: ... pCFD4-U6:1_U6:3 was a gift from Simon Bullock (Addgene plasmid #49411 ...
-
bioRxiv - Plant Biology 2023Quote: ... a C-terminal 3×FLAG® epitope tag (pICSL50007; Addgene #50308), and 3′ UTR and terminator sequences from Agrobacterium tumefaciens nopaline synthase (AtuNOST ...
-
bioRxiv - Microbiology 2023Quote: ... pCfB2904(XI-3 MarkerFree) was a gift from Irina Borodina (Addgene plasmid # 73276 ...
-
bioRxiv - Biochemistry 2023Quote: The plasmid used to express Cas1 and Cas2/3 (Addgene #89240) was PCR amplified with mutagenic primer pairs using Q5 polymerase (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... we injected 3×100 nl AAV5.Ef1a.DIO.eYFP (Penn Core, Addgene: 27056) into the mPFC (AP/ML/DV coordinates 2.2 ...
-
bioRxiv - Developmental Biology 2021Quote: A mouse Cnr1 cDNA fragment (Addgene, #13391) was cloned into all-in-one tetracycline inducible plasmid (pAS4.1w.Ppuro-aON ...
-
bioRxiv - Cell Biology 2021Quote: ... and mCherry-Climp63(mouse) (Addgene plasmid #136293) were gifts from Gia Voeltz36 ...
-
bioRxiv - Neuroscience 2023Quote: ... and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527 ...
-
bioRxiv - Immunology 2021Quote: The SARS-CoV-2 pseudoviral particles expressing COVID-19 spike protein pGBW m4137384: S protein was purchased from Addgene (149543) and the virus particles were produced as describe previously (Hoffmann et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmid encoding for mitochondria specific protein/ autophagosome specific protein is transfected in HEK293T cells along with packaging vector (pDR8.2; Addgene #8455) and envelope encoding protein (VSVG ...
-
bioRxiv - Cell Biology 2023Quote: ... Ras GTPase-activating protein-binding protein 1 (G3BP1) phage UbiC G3BP1-GFP-GFP was a gift from Jeffrey Chao (Addgene plasmid # 119950 ...
-
bioRxiv - Biochemistry 2020Quote: ... anti-mouse IgG AlexaFluor-488 (Life Technologies A11029-EA. The following plasmids were used: mouse PM20D1-flag (Addgene 84566). pENN.AAV.tMCK.PI.eGFP.WPRE.bGH (Addgene 105556) ...
-
bioRxiv - Molecular Biology 2021Quote: ... (i) 0.5 μg of AAVS1-TALEN-L and AAVS1-TALEN-R (gift from Dr. Danwei Huangfu, Addgene plasmid # 59025) as well as 2 μg of targeting plasmid were used for nucleofection of hPSC cells ...
-
bioRxiv - Cell Biology 2021Quote: ... mScarlet-i-H2A construct was amplified by PCR from pmScarlet-i_H2A_C1 (a gift from Dorus Gadella, Addgene plasmid #85053) (Bindels et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... U2OS and HEK293 cells were seeded into 10 cm plates 24 h prior to transfection with 2.5 µg of the I-SceI expression vector pCBA-SceI (Addgene plasmid # 26477 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The gene encoding Cas3/I-G was cloned into pET Strep II TEV LIC cloning vector (1R, Addgene #29664). All the clones were confirmed by Sanger sequencing ...
-
bioRxiv - Cell Biology 2023Quote: The pMTS-mScarlet-I-N1 (mito-mScarlet) was a gift from Dorus Gadella (Addgene plasmid 85059; RRID: Addgene 85059) (Bindels et al. ...
-
bioRxiv - Cell Biology 2023Quote: The pMTS-mScarlet-I-N1 (mito-mScarlet) was a gift from Dorus Gadella (Addgene plasmid 85059; RRID: Addgene 85059) (Bindels et al. ...
-
bioRxiv - Systems Biology 2021Quote: ... and envelope protein pCMV-VSV-G (Addgene #8454) according to the manufacturer’s instructions ...