Labshake search
Citations for Addgene :
6101 - 6150 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... and pMD2.G (Addgene, 12259) using FuGENE transfection reagent (Fisher ...
-
bioRxiv - Biochemistry 2023Quote: ... (Addgene, 12253) and pMD2.G (Addgene ...
-
bioRxiv - Biochemistry 2023Quote: ... Lentivirus was generated by co-transfection of HEK293T cells with destination vector plasmid DNA and the packaging plasmids pMDLg/pRRE (Addgene, 12251), pRSV-Rev ...
-
bioRxiv - Biochemistry 2023Quote: ... BFP-Parkin (Addgene, 186221) and pSu9-Halo-GFP (Addgene ...
-
bioRxiv - Biochemistry 2023Quote: ... These donor constructs were then used to transfer their insert into destination vectors: pLX304-CMV-Blast (Addgene, 25890), pLenti-CMV-Hygro (w117-1 ...
-
bioRxiv - Biochemistry 2023Quote: ... pLenti-CMV-Hygro (w117-1) (Addgene, 17454 a gift from Eric Campeau & Paul Kaufman) ...
-
bioRxiv - Biochemistry 2023Quote: A Halo-based assay to measure mitophagy was recently developed using pSu9-Halo-mGFPplasmid (Addgene, 184905) 53 ...
-
Multi-omics characterization of partial chemical reprogramming reveals evidence of cell rejuvenationbioRxiv - Molecular Biology 2023Quote: ... or the reverse tetracycline transactivator36 (Addgene #20342), were encapsulated in PureFection nanoparticles (System Biosciences ...
-
Multi-omics characterization of partial chemical reprogramming reveals evidence of cell rejuvenationbioRxiv - Molecular Biology 2023Quote: ... along with either the polycistronic OSKM cassette35 (Addgene #20328) or the reverse tetracycline transactivator36 (Addgene #20342) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The sequence of a single guide RNA (sgRNA) specifically targeting the 3’ end of TGRH88_003980_t1 was integrated into pSAG1::CAS9-GFPU6::sgUPRT (Addgene plasmid # 54467) using the Q5-site directed mutagenesis kit (NEB) ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmid pEGFP-Q74 was a gift from David Rubinsztein (Addgene # 40261) (Narain et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids Ub-M-GFP and Ub-R-GFP were a gift from Nico Dantuma (Addgene #11939) (Dantuma et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... and cloned into pLKO.1 (Addgene #10878). The VSV-G envelope expressing plasmid pMD2.G ...
-
bioRxiv - Cell Biology 2023Quote: ... The autophagy reporter plasmid FUW mCherry-GFP-LC3 was a gift from Anne Brunet (Addgene #110060) (Leeman et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... and pSpCas9(BB)-2A-Puro (PX459) a gift from Feng Zhang (Addgene # 48139) (Kirschke et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... S499A and S499D plasmids were a gift from Stephanie Ceman (Addgene plasmids #87929, #87913 and #87914). HaloTag versions of FMRP reporters were generated by replacing GFP with HaloTag ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... pPD96.32 was a gift from Andrew Fire (Addgene plasmid # 1504 ; http://n2t.net/addgene:1504 ; RRID:Addgene_1504). The amplified dat-1 promoter was inserted into the plasmid containing the MLS and GFP using Gibson Assembly and insertion was confirmed by colony PCR with a nested GFP reverse primer and M13 Forward primer ...
-
bioRxiv - Cell Biology 2023Quote: ... and was performed by the Leuven Viral Vector Core using transfer plasmids for lentiviral vector production (Addgene, plasmid RRIDs: Addgene_171770, Addgene_171789, Addgene_204474, Addgene_204481, Addgene_171790 ...
-
bioRxiv - Cell Biology 2023Quote: ... and was performed by the Leuven Viral Vector Core using transfer plasmids for lentiviral vector production (Addgene, plasmid RRIDs: Addgene_171770 ...
-
bioRxiv - Cell Biology 2023Quote: ... and was performed by the Leuven Viral Vector Core using transfer plasmids for lentiviral vector production (Addgene, plasmid RRIDs ...
-
bioRxiv - Cell Biology 2023Quote: ... and was performed by the Leuven Viral Vector Core using transfer plasmids for lentiviral vector production (Addgene, plasmid RRIDs: Addgene_171770, Addgene_171789, Addgene_204474, Addgene_204481, Addgene_171790, Addgene_171824, Addgene_204475, Addgene_171823 ...
-
bioRxiv - Cell Biology 2023Quote: ... and was performed by the Leuven Viral Vector Core using transfer plasmids for lentiviral vector production (Addgene, plasmid RRIDs: Addgene_171770, Addgene_171789, Addgene_204474, Addgene_204481, Addgene_171790, Addgene_171824 ...
-
bioRxiv - Cell Biology 2023Quote: ... and ATP10B variants (O94823.2, WT, RRID: Addgene_203695 ...
-
bioRxiv - Cell Biology 2023Quote: ... and was performed by the Leuven Viral Vector Core using transfer plasmids for lentiviral vector production (Addgene, plasmid RRIDs: Addgene_171770, Addgene_171789, Addgene_204474, Addgene_204481, Addgene_171790, Addgene_171824, Addgene_204475 ...
-
bioRxiv - Cell Biology 2023Quote: ... and ATP10B variants (O94823.2, WT, RRID: Addgene_203695; catalytic mutations E210A and D433N, RRIDs: Addgene_203697 and Addgene_ 203696); and pathogenic variants R153X ...
-
bioRxiv - Cell Biology 2023Quote: ... and was performed by the Leuven Viral Vector Core using transfer plasmids for lentiviral vector production (Addgene, plasmid RRIDs: Addgene_171770, Addgene_171789 ...
-
bioRxiv - Cell Biology 2023Quote: ... HeLa cells were co-transfected with pcDNA3.0 plasmids containing human CDC50A (NM_018247, N-terminal FLAG tag; RRID: Addgene_203694) and ATP10B variants (O94823.2 ...
-
bioRxiv - Cell Biology 2023Quote: ... and ATP10B variants (O94823.2, WT, RRID: Addgene_203695; catalytic mutations E210A and D433N, RRIDs: Addgene_203697 and Addgene_ 203696); and pathogenic variants R153X ...
-
bioRxiv - Cancer Biology 2023Quote: ... expressing Tp53 sgRNA (CCTCGAGCTCCCTCTGAGCC) and the pLKO.1-Hygro (Addgene Plasmid #24150) expressing Nf1 sgRNA (GTTGTGCTCGGTGCTGACTT) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cells were sequentially transduced with lentiviruses of the lentiCRISPR-Puro (Addgene plasmid #52961) expressing Tp53 sgRNA (CCTCGAGCTCCCTCTGAGCC ...
-
bioRxiv - Neuroscience 2023Quote: ... The plasmid pCAG_EGFP_GPI (plasmid #32601) was obtained from AddGene and digested with SacI and XhoI to generate a vector fragment for insertion of GeNL and GeNL_SS for GPI-anchored extracellular display ...
-
bioRxiv - Neuroscience 2023Quote: ... Mammalian expression plasmids encoding GeNL(Ca2+)_48017 (plasmid #85205) and CaMBI18 (plasmid #124094) were obtained from AddGene. The plasmid pCAG_EGFP_GPI (plasmid #32601 ...
-
bioRxiv - Neuroscience 2023Quote: ... Mammalian expression plasmids encoding GeNL(Ca2+)_48017 (plasmid #85205) and CaMBI18 (plasmid #124094) were obtained from AddGene and amplified by PCR (primers ...
-
bioRxiv - Neuroscience 2023Quote: pAAV-hSyn-CheRiff-eGFP was a gift from Adam Cohen (Addgene plasmid # 51697; htp://n2t.net/addgene:51697; RRID:Addgene_51697)
-
bioRxiv - Neuroscience 2023Quote: GeNL(Ca2+)_520/pcDNA3 was a gift from Takeharu Nagai (Addgene plasmid # 85204 ...
-
bioRxiv - Neuroscience 2023Quote: pLenti-CaMKIIa-hChR2(C128S)-EYFP-WPRE was a gift from Karl Deisseroth (Addgene plasmid # 20294; htp://n2t.net/addgene:20294; RRID:Addgene_20294)
-
bioRxiv - Neuroscience 2023Quote: pFUGW-hGtACR2-EYFP was a gift from John Spudich (Addgene plasmid # 67877; htp://n2t.net/addgene:67877; RRID:Addgene_67877)
-
bioRxiv - Neuroscience 2023Quote: GeNL(Ca2+)_520/pcDNA3 was a gift from Takeharu Nagai (Addgene plasmid # 85204; htp://n2t.net/addgene:85204; RRID:Addgene_85204)
-
bioRxiv - Neuroscience 2023Quote: pFUGW-hGtACR2-EYFP was a gift from John Spudich (Addgene plasmid # 67877 ...
-
bioRxiv - Neuroscience 2023Quote: ... neurons were transduced with AAV9-Syn (5 x 109 gc per well) encoding jGCaMP8s (AddGene 162374) or CaBLAM (in house prep) ...
-
bioRxiv - Neuroscience 2023Quote: pLenti-CaMKIIa-hChR2(C128S)-EYFP-WPRE was a gift from Karl Deisseroth (Addgene plasmid # 20294 ...
-
bioRxiv - Neuroscience 2023Quote: pAAV.Syn.GCaMP6f.WPRE.SV40 was a gift from Douglas Kim & GENIE Project (Addgene plasmid # 100837; htp://n2t.net/addgene:100837; RRID:Addgene_100837)
-
bioRxiv - Neuroscience 2023Quote: pAAV-hSyn-CheRiff-eGFP was a gift from Adam Cohen (Addgene plasmid # 51697 ...
-
bioRxiv - Developmental Biology 2023Quote: ... apr-1 and ecps-1 were obtained from a library supplied by Ahringer (Addgene) (Kamath et al ...
-
bioRxiv - Microbiology 2023Quote: ... a gift from Keith Joung (Addgene plasmid # 43861 ...
-
bioRxiv - Cell Biology 2023Quote: ... and was performed by the Leuven Viral Vector Core using transfer plasmids for lentiviral vector production (Addgene, plasmid RRIDs: Addgene_171770, Addgene_171789, Addgene_204474, Addgene_204481 ...
-
bioRxiv - Cell Biology 2023Quote: ... and was performed by the Leuven Viral Vector Core using transfer plasmids for lentiviral vector production (Addgene, plasmid RRIDs: Addgene_171770, Addgene_171789, Addgene_204474 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The mito-roGFP2- Grx1 coding sequence was adapted from pUAST mito roGFP2-Grx1 (Addgene Plasmid# 64995) by codon optimizing for expression in C ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The Perceval-HR coding sequence was adapted from pRsetB-his7-Perceval (Addgene Plasmid# 20336) by codon optimizing for C ...
-
bioRxiv - Developmental Biology 2023Quote: ... which was constructed with pX458 vector (Addgene #42230) by ligating oligos into it (MFN2 exon3 target site ...