Labshake search
Citations for Addgene :
5901 - 5950 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... mouse naïve CD4+ T cells were transfected with p8xEGFP-N1 (Addgene # 122168, gift from Georg Mayr) which expresses 8 concatemeric EGFP proteins ...
-
bioRxiv - Molecular Biology 2023Quote: ... pCMV_VSVG (Addgene, 8454, 1.5 µg), psPAX2 (Addgene 12260 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 0.25 µg pCMV_VSVG (Addgene 8454), 1.25 µg psPAX2 (Addgene 12260) ...
-
bioRxiv - Molecular Biology 2023Quote: ... psPAX2 (Addgene 12260, 9 µg), the guide containing vector (pXPR_066 ...
-
bioRxiv - Cancer Biology 2023Quote: ... the murine shRNA hairpins pLKO.1-shCdkn2a #1 (TRCN0000077816) and #2 (TRCN0000362595) and the human and murine pLKO.1-shGFP control (Addgene, cat#30323) vectors were packaged using the ViraPower Kit (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... lentiCas9-Blast was a gift from Feng Zhang (Addgene plasmid # 52962). Lenti-dCas9-KRAB-blast was a gift from Gary Hon (Addgene plasmid # 89567) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Kivanc Birsoy (Addgene, cat#160129). The screening using the human nucleotide-focused library was conducted on SKMEL28 shGFP control and shp16 cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... and ligated into pLentiCRISPRv2 (Addgene, cat#52961), kindly gifted by Feng Zhang ...
-
bioRxiv - Microbiology 2023Quote: ... and pRSV-Rev (Addgene plasmid # 12253) were gifts from Didier Trono ...
-
bioRxiv - Microbiology 2023Quote: ... Lenti-dCas9-KRAB-blast was a gift from Gary Hon (Addgene plasmid # 89567). Sequences used are listed in Supplementary Data 6.
-
bioRxiv - Microbiology 2023Quote: ... pMDLg/pRRE (Addgene plasmid # 12251) and pRSV-Rev (Addgene plasmid # 12253 ...
-
bioRxiv - Microbiology 2023Quote: pMD2.G (Addgene plasmid # 12259), pMDLg/pRRE (Addgene plasmid # 12251 ...
-
bioRxiv - Microbiology 2023Quote: ... pMCB320 was a gift from Michael Bassik (Addgene plasmid # 89359). lentiCas9-Blast was a gift from Feng Zhang (Addgene plasmid # 52962) ...
-
bioRxiv - Genetics 2023Quote: ... which was a gift from Feng Zhang (Addgene, 52963). BSD-WPRE was from lentiCas9-Blast ...
-
bioRxiv - Genetics 2023Quote: ... which was a gift from Pantelis Tsoulfas (Addgene, 71545). The EF-1α promoter was taken from lentiGuide-Puro ...
-
bioRxiv - Genetics 2023Quote: ... 2 µg pMD2.G (Addgene, 12259), 9 µg lentiviral plasmid ...
-
bioRxiv - Genetics 2023Quote: ... which was a gift from Feng Zhang (Addgene, 52961). DAG1 coding exons were cloned from human genome DNA by PCR ...
-
bioRxiv - Neuroscience 2023Quote: We transiently expressed the phototoxic KillerRed protein in Tg(SAIG213A:EGFP) fish by injecting a plasmid expressing KillerRed driven by UAS promoter (Addgene plasmid # 115516 ...
-
bioRxiv - Microbiology 2023Quote: ... The CgMET3 promoter was amplified from pCU-MET3 (Maroc and Fairhead 2019) (AddGene #45336). The Msn2 and Msn4-GFP expression plasmids were made by inserting the coding sequence of the genes in between the PDC1 promoter and GFP in the pCU-PDC1-GFP vector (Zordan et al ...
-
bioRxiv - Biophysics 2023Quote: ... envelope plasmid VSV-G (Addgene #12259) and transfer plasmids at a ratio of 9:4:14 ...
-
bioRxiv - Bioengineering 2023Quote: ... a red fluorescent calcium sensor protein (RCaMP) was amplified from pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene cat#100853) using primers 5’-ACTAGTATGCTGCAGAACGAGCTTGC and ACCGGTCTACTAGTCTCAATTGTCACTTCGCTGTCATCATTTGT ...
-
bioRxiv - Bioengineering 2023Quote: ... pAAV-hSyn-DIO-MCS is pAAV-hSyn-DIO-hM3D(Gq)-mCherry (Addgene cat# 44361) which had previously had the BsrGI/NheI region containing hM3D(Gq)-mCherry replaced with the following multiple cloning site ...
-
bioRxiv - Cell Biology 2023Quote: ... and a PCL-Eco packaging plasmid (Addgene, 12371 ...
-
bioRxiv - Cell Biology 2023Quote: ... we measured intramitochondrial free Ca2+ levels by transfecting AML12 cells with the CMV-mito-GEM-GECO1 plasmid (Addgene, 32461 ...
-
bioRxiv - Cell Biology 2023Quote: ... to co- transfect HEK 293FT cells with plasmids containing the packaging gag/pol and envelope pCMV- 435VSV-G genes and either the pMRX-IB-HaloTag7-mGFP-KDEL (Addgene, 184904 ...
-
bioRxiv - Cell Biology 2023Quote: ... Retroviruses were produced by transfecting HEK 293FT cells with a pBABE-puro-mCherry-EGFP-LC3B plasmid (Addgene, 22418 ...
-
bioRxiv - Cell Biology 2023Quote: ... each well was transfected with 1.5 µg of the plasmid containing the YFP-Parking gene (Addgene, 23955 ...
-
bioRxiv - Biophysics 2023Quote: ... HEK293T cells were co-transfected with the second-generation packaging plasmid psPAX2 (Addgene #12260), envelope plasmid VSV-G (Addgene #12259 ...
-
bioRxiv - Microbiology 2023Quote: ... The Msn2 and Msn4-GFP expression plasmids were made by inserting the coding sequence of the genes in between the PDC1 promoter and GFP in the pCU-PDC1-GFP vector (Zordan et al. 2013) (AddGene #45342). The ScDAL80-GFP reporter was constructed by amplifying the 1kb upstream region of ScDAL80 and placing it in front of a yeGFP in a pRS426 (ATCC #77107 ...
-
bioRxiv - Neuroscience 2023Quote: ... 300 ul of AAV9-syn-jGCaMP7s-WPRE (Addgene viral prep #104487-AAV9) was diluted to 1012 vg/ml and injected into the left and caudal portion of the ventrolateral VP in C57BL6/J mice ...
-
bioRxiv - Neuroscience 2023Quote: ... 500 ul of AAV9-syn-FLEX-jGCaMP7s-WPRE (Addgene viral prep #104491-AAV9) was diluted to 1012 vg/ml and injected into the left and rostral portion of the medial OT in D1-Cre or A2A-Cre mice ...
-
bioRxiv - Neuroscience 2023Quote: ... The amplicons were inserted into the pCMV-Tag-2b or pGEX-5X-3 vector (Addgene). Spastin mutants were generated using the Quickchange Kit (Agilent ...
-
bioRxiv - Developmental Biology 2023Quote: DNA fragments coding for full-length human Deltex1 (1863bps) was inserted into the pcDNA3.1-HA (Addgene #128034) mammalian expression vector with an N-terminal HA tag ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... aegypti LVP embryos co-injected with 80 fmol/µL each of the pHsp70-Cas9 vector (Addgene 45945) and an sgRNA expressing plasmid containing the U6:3 promoter for AAEL017774 (U6 spliceosomal RNA ...
-
bioRxiv - Biophysics 2023Quote: ... pANAP was a gift from Peter Schultz (Addgene plasmid # 48696 ...
-
bioRxiv - Biophysics 2023Quote: ... pANAP was a gift from Peter Schultz (Addgene plasmid # 48696 ; http://n2t.net/addgene:48696 ; RRID:Addgene_48696) (Chatterjee et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... using a standard protocol from Addgene.
-
bioRxiv - Neuroscience 2023Quote: ... 2.0 μl of AAV2/5.CAG.GCaMP6s.WPRE.SV40 (titer: 1X1013; Addgene) was injected into the left trigeminal ganglion (TG ...
-
bioRxiv - Cell Biology 2023Quote: ... pHAGE-TEX264(deltaLIR,F273A)-GFP (Addgene 201926 10); pHAGEmCherry-LC3B (Addgene 201924 10).
-
bioRxiv - Cell Biology 2023Quote: ... pHAGE-FAM134C-GFP (this paper, Addgene 201927); pHAGE-TEX264-GFP (Addgene 201925 10) ...
-
bioRxiv - Cell Biology 2023Quote: ... pAC150-FAM134C-GFP (this paper, Addgene 201932); pAC150-TEX264-GFP (this paper ...
-
bioRxiv - Cell Biology 2023Quote: ... pAC150-Keima-VAPA (this paper, Addgene in process); pAC150-Keima-REEP5 (this paper ...
-
bioRxiv - Cell Biology 2023Quote: ... pAC150-TEX264(deltaLIR, F273A)-GFP (this paper, Addgene 201930), pHAGE-FAM134C-GFP (this paper ...
-
bioRxiv - Cell Biology 2023Quote: ... pAC150-TEX264-GFP (this paper, Addgene 201931); pAC150-TEX264(deltaLIR ...
-
bioRxiv - Cell Biology 2023Quote: ... pHAGE-TEX264-GFP (Addgene 201925 10); pHAGE-TEX264(deltaLIR,F273A)-GFP (Addgene 201926 10) ...
-
bioRxiv - Cell Biology 2023Quote: ... pAC150-Keima-REEP5 (this paper, Addgene 201928); pAC150-FAM134C-GFP (this paper ...
-
bioRxiv - Biochemistry 2023Quote: ... we constructed a constitutive all-in-one dead SaCas9 (dSaCas9) system from construct (Addgene #164563) via Gibson Assembly Master Mix (NEB ...
-
bioRxiv - Biochemistry 2023Quote: ... into the digested AID’-BE4max (Addgene #174696) via T4 DNA ligase (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... These include pAC150-Keima-RAMP4 (this paper, Addgene 201929); pAC150-Keima-VAPA (this paper ...
-
bioRxiv - Cell Biology 2023Quote: ... pHAGEmCherry-LC3B (Addgene 201924 10).