Labshake search
Citations for Addgene :
6151 - 6200 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... These fragments are individually cloned into between a polyhedrin promotor and terminator sequences on the plasmid vector pLIB (Addgene, Catalog # 80610) to create the gene expression cassettes (GECs) ...
-
bioRxiv - Cell Biology 2023Quote: ... mCherry-Arp3 (Wu Lab plasmid code A36) was a gift from Michael Davidson (Addgene plasmid #54981). LifeAct-GFP (Wu Lab plasmid code A11 ...
-
bioRxiv - Cell Biology 2023Quote: ... Cloning of Def16 sequence to pET plasmid containing an N-terminus Hisx6 tag and GFP (Addgene # 29663) was done by whole plasmid amplification using the indicated forward and reverse primers for GFP-Def16 (primers 1 and 2 ...
-
bioRxiv - Cell Biology 2023Quote: ... and psPAX2 (Addgene, 12260) using PEI MAX transfection reagent (Polyscience ...
-
bioRxiv - Cell Biology 2023Quote: ... 25 μg of pT/Caggs-NRASV12 or pT/Caggs-NRASV12/D38A and 5 μg of PT2/c-Luc//PGK-SB-13 (Addgene, 20207) were suspended in 0.9% saline solution at a final volume of 10% of the body weight and injected via the tail vein within 8 seconds ...
-
bioRxiv - Cell Biology 2023Quote: ... we purchased gene-synthesized codon-optimized GST-TEV-SINTBAD-EGFP and GST-TEV-SINTBAD-mCherry in a pFastBac-Dual vector from Genscript (RRID:Addgene_198035 and RRID:Addgene_208874). The constructs were used to generate bacmid DNA ...
-
bioRxiv - Cell Biology 2023Quote: ... a point mutation was introduced into pT/Caggs-NRASV12 (Addgene, #20205) by PCR using a PrimeSTAR Mutagenesis Basal Kit (Takara ...
-
bioRxiv - Cell Biology 2023Quote: ... into the mTurquoise2-N1 plasmid (Addgene plasmid #54843;http://n2t.net/addgene:54843;RRID:Addgene_54843 ...
-
bioRxiv - Cell Biology 2023Quote: ... the DNA sequence of μNS was obtained from pRS306-PHIS3-GFP-μNS (Addgene plasmid #116935 ...
-
bioRxiv - Developmental Biology 2023Quote: HEK293T cells were plated at a density of 2.8×105 cells in 6-well plates and transfected with MSCV-flag-PRDM16 (Addgene, 15504; RRID:MSCV PRDM16) and/or pCDNA3-NKX2-174 using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2023Quote: TALEN plasmids were constructed using the Platinum Gate TALEN Kit (Kit #1000000043, Addgene, Cambridge, MA) as previously described (Sakuma et al. ...
-
bioRxiv - Cell Biology 2023Quote: The bacterial expression vector for pET28a-EGFP-CNA35 was a gift from Maarten Merkx (Addgene plasmid # 61603 ...
-
bioRxiv - Cell Biology 2023Quote: pSpCas9(BB)-2A-Puro (PX459) V2.0 used to generate the knockouts of this study was a gift from Feng Zhang lab (Addgene, plasmid #62988)77 ...
-
bioRxiv - Cell Biology 2023Quote: ... Vector was purchased from Addgene (https://www.addgene.org/17448/) and cloned CMV promoter to EF1a ...
-
bioRxiv - Cell Biology 2023Quote: ... CRISPR cell lines were generated using lentiCRISPRv1 or lentiCRISPRv2 vector (Addgene #52961) containing puromycin ...
-
bioRxiv - Cell Biology 2023Quote: ... For retroviral transfections 1 μg VSVG and 1.86 μg HIV gag-pol (Addgene #14887) were used ...
-
bioRxiv - Developmental Biology 2023Quote: ... The human TBXT sgRNA (CAGAGCGCGAACTGCGCGTG) was a gift from Jacob Hanna (Addgene plasmid #59726 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The human TBXT sgRNA (CAGAGCGCGAACTGCGCGTG) was a gift from Jacob Hanna (Addgene plasmid #59726; http://n2t.net/addgene:59726; RRID: Addgene_59726) and targeted the first exon of the TBXT gene ...
-
Self-organised pattern formation in the developing neural tube by a temporal relay of BMP signallingbioRxiv - Developmental Biology 2023Quote: ... PB-TRE-EGFP-EF1a-rtTA (Addgene, Plasmid #104454) was digested with NheI and KpnI and the Lmx1a CDS and IRES-GFP fragments were inserted using the In-Fusion HD Cloning kit (Takara) ...
-
bioRxiv - Cell Biology 2023Quote: ... pHAGE-FKBP-GFP-NAP1 delta-FIP200 (I11S/L12S) (RRID:Addgene_208864), pHAGE-FKBP-GFP-NAP1 delta-TBK1 (L226Q/L233Q ...
-
bioRxiv - Cell Biology 2023Quote: ... pBMN-mEGFP-NDP52 (RRID:Addgene_188785), pBMN-BFP-Parkin (RRID:Addgene_186221) ...
-
bioRxiv - Cell Biology 2023Quote: The following lentiviral vectors were used in this study: pHAGE-FKBP-GFP-NDP52 (RRID:Addgene_135296), pHAGE-FKBP-GFP-NAP1 (RRID:Addgene_208862) ...
-
bioRxiv - Cell Biology 2023Quote: ... and pCHAC-mito-mKeima (RRID:Addgene_72342). Empty backbones used to generate these retroviral vectors were pBMN-HA-C1 (RRID:Addgene_188645) ...
-
bioRxiv - Cell Biology 2023Quote: ... Empty backbones used to generate these retroviral vectors were pBMN-HA-C1 (RRID:Addgene_188645), pBMN-mEGFP (RRID:Addgene_188643) ...
-
bioRxiv - Cell Biology 2023Quote: ... pHAGE-FKBP-GFP-NAP1 delta-TBK1 (L226Q/L233Q) (RRID:Addgene_208865), pHAGE-FKBP-GFP-OPTN (RRID:Addgene_208866) ...
-
bioRxiv - Cell Biology 2023Quote: ... pHAGE-FKBP-GFP-OPTN (2-119) (RRID:Addgene_208867), pHAGE-mt-mKeima-P2A-FRB-Fis1 (RRID:Addgene_135295).
-
bioRxiv - Cell Biology 2023Quote: ... Human NDP52 cDNA was cloned into a pGST2 vector with an N-terminal GST tag followed by a TEV cleavage site (RRID:Addgene_187828). After the transformation of the pGST2 vector encoding GST-TEV-NDP52 in E ...
-
bioRxiv - Cell Biology 2023Quote: ... we cloned human OPTN cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_190191). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-OPTN in E ...
-
bioRxiv - Cell Biology 2023Quote: Linear tetra-ubiquitin fused to GST (GST-4×Ub) was cloned into a pGEX-4T1 vector (RRID:Addgene_199779). After the transformation of the pGEX-4T1 vector encoding GST-4×Ub in E ...
-
bioRxiv - Immunology 2023Quote: ... pVITRO1-Trastuzumab-IgG2 (Addgene plasmid #61884; RRID: Addgene_61884), IgG3 (Addgene plasmid #61885 ...
-
bioRxiv - Immunology 2023Quote: ... and IgG4 (Addgene plasmid #61887; RRID:Addgene_61887) was a gift from Andrew Beavils lab (44) ...
-
bioRxiv - Immunology 2023Quote: ... and IgG4 (Addgene plasmid #61887; RRID:Addgene_61887) was a gift from Andrew Beavils lab (44) ...
-
bioRxiv - Immunology 2023Quote: ... and pInducer20 vectors from Addgene. Site-directed mutagenesis was performed using the QuikChange II Site-directed mutagenesis kit (Agilent ...
-
bioRxiv - Genomics 2023Quote: ... The amplified fragments were then inserted into SbfI/AgeI site of the pLS-SceI vector (Addgene, 137725) using NEBuilder HiFi DNA Assembly mix (NEB ...
-
bioRxiv - Genetics 2023Quote: ... xiap and p47 were cloned in DsRed2-N1(a gift from Michael Davidson, Addgene plasmid #54493) and pAQUA-N1vectors (a gift from Fabienne Merola ...
-
bioRxiv - Genetics 2023Quote: ... and pAQUA-N1vectors (a gift from Fabienne Merola, Addgene plasmid # 42888). Genes of interest were amplified from ISE6 cells complementary DNA (cDNA ...
-
bioRxiv - Genetics 2023Quote: ... and pMD2.G (Addgene, catalog no. 12259) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Genetics 2023Quote: pCDNA3.1 phiC31 integrase (Addgene #68310)20,22 plasmid was linearized with BamHI and transcribed using the T7 mMessage mMachine kit (ThermoFisher AM1344) ...
-
bioRxiv - Genetics 2023Quote: ... and 1.5 µg AAVS1 TALEN R (Addgene 59026) using Lipofectamine 3000 Transfection Reagent (Invitrogen L3000015 ...
-
bioRxiv - Genomics 2023Quote: ... The DR274 plasmid (Addgene # 42250) was used as a template for PCR using a universal primer (AAAAGCACCGACTCGGTGCCACT ...
-
bioRxiv - Genetics 2023Quote: ... by performing gibson assembly with the TRE3G promoter and P2A-BFP-WPRE amplified from TRE-KRAB-dCas9-IRES-BFP (addgene #85449) combined with nCas9(H840A)-MMLV(RT) amplified from pLenti-Synapsin-hChR2(H134R)-EYFP-WPRE (Addgene# 20945) and 7.3Kb (lentiviral backbone ...
-
bioRxiv - Genetics 2023Quote: We plated 550,000 HEK293T cells on 6-well plates and 24 hours later we transfected the cells with 900 ng psPAX2 packaging vector (Addgene #12260), 360 ng pMD2.g VSV-G envelope vector (Addgene #12259) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Plasmid libraries are available from Addgene (Addgene IDs 208081-208084). Plasmid libraries were transformed into the AWY101 yeast strain (Wentz and Shusta 2007 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Parental plasmids and associated sequence maps are available from Addgene (Addgene ID 208085 and 208086).
-
bioRxiv - Genetics 2023Quote: ... [31] or pSB700 expressing blasticidin resistance (pSB700-Blast; kindly provided by George Church; Addgene plasmid #64046) [32] ...
-
bioRxiv - Developmental Biology 2023Quote: ... flanked by Xba1 sites was generated by touch down PCR using pUAST-Rab35-6myc (Addgene #53503) as template.
-
bioRxiv - Developmental Biology 2023Quote: The myl12.1 coding sequence was amplified from the targeting plasmid pUC19-homology-arm-myl12.1-mScarlet-FRT-galK-FRT-homology-arm (Yamaguchi et al., 2022) and the mNeonGreen coding sequence was amplified from mNeonGreen-mTurquoise2 plasmid (Addgene #98886) (Mastop et al. ...
-
bioRxiv - Developmental Biology 2023Quote: Full length fmi cDNA from UAS-fmi (ref 7) was subcloned in two EcoR1-Xho1fragments into pQUAST (#24349; Addgene) and transformed into w1118 flies to generate random genomic insertions.
-
bioRxiv - Developmental Biology 2023Quote: Plasmids #123461 (pA/G-MNase) and #124601 (3XFlag-pA-Tn5-Fl) were ordered from Addgene. ProteinA and ProteinG were amplified using the primer pairs (FZ461_ProtA_rev ...
-
bioRxiv - Genomics 2023Quote: ... or ZIM3-dCas9-2A-puro-2A-GFP (200ng) and pCFD3 (Addgene, 49410) (200ng ...