-
No products found
because this supplier's products are not listed.
Alexandre Plessier, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... 5 mM Amino-guanidine hydrochloride (Sigma-Aldrich), and 10 μM Biotin Picolyl azide or Biotin azide (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Katharina MC Klee, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5% nonessential amino acids (Gibco), and 10% FBS (Gibco ...
-
No products found
because this supplier's products are not listed.
Carlos Perez, et al.,
bioRxiv - Neuroscience 2020
Quote:
NNC-711 (1,2,5,6-Tetrahydro-1-[2-[[(diphenylmethylene)amino]oxy]ethyl]-3-pyridinecarboxylic acid hydrochloride) from Tocris
-
No products found
because this supplier's products are not listed.
Jia C. Wang, et al.,
bioRxiv - Immunology 2022
Quote:
... 1,2-dioleoyl-sn-glycero-3-[(N-(5-amino-1-carboxypentyl)iminodiacetic acid)succinyl] (DGS)–NTA and 1,2-dioleoyl-sn-glycero-3-phosphocholine (Avanti Polar Lipids, Inc.) were mixed at 1:3:96 molar % ratio ...
-
No products found
because this supplier's products are not listed.
Lucas H. Armitage, et al.,
bioRxiv - Immunology 2021
Quote:
... nonessential amino acids (Corning), Glutamax ...
-
No products found
because this supplier's products are not listed.
Iris C. Swart, et al.,
bioRxiv - Microbiology 2024
Quote:
... nonessential amino acids (Lonza), penicillin (100 IU/ml) ...
-
No products found
because this supplier's products are not listed.
Romain D. Cazé, et al.,
bioRxiv - Neuroscience 2023
Quote:
D-AP5 (D-(−)-2-Amino-5-phosphonopentanoic acid) and SR 95531 (2-(3-Carboxypropyl)-3-amino-6-(4 methoxyphenyl) pyridazinium bromide) were purchased from Abcam, UK ...
-
No products found
because this supplier's products are not listed.
Aaron S. Mendez, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 10μM amino acids (Promega), 0.21mM spermidine ...
-
No products found
because this supplier's products are not listed.
Marcin G Fraczek, et al.,
bioRxiv - Genetics 2022
Quote:
... or SD complete amino acid agar (0.67% yeast nitrogen base with amino acids (Merck), 2% glucose ...
-
No products found
because this supplier's products are not listed.
Elizabeth M Avegno, et al.,
bioRxiv - Neuroscience 2020
Quote:
... SCH 23390 hydrochloride (5 μM; R&D Systems, Minneapolis, MN, USA) was added to the aCSF ...
-
No products found
because this supplier's products are not listed.
Simonne Griffith-Jones, et al.,
bioRxiv - Biochemistry 2023
Quote:
A 27 amino acid peptide containing amino acids 340-366 of RAD18 was purchased from GenScript and used at 200 µM for ITC binding experiments ...
-
No products found
because this supplier's products are not listed.
Anika J. Friedman, et al.,
bioRxiv - Biochemistry 2022
Quote:
... and 2-[(Carboxy-carbonyl)amino]-4,5,6,7-tetrahydrothieno[2,3-c]pyridine-3-carboxylic acid hydrochloride (TCS 401) from Cayman Chemical (Ann Arbor, Michigan) and Ertiprotafib from Med-Koo Biosciences ...
-
No products found
because this supplier's products are not listed.
Androniqi Qifti, et al.,
bioRxiv - Physiology 2021
Quote:
... 1% non-essential amino acids (VWR) and 1% L-glutamine (VWR) ...
-
No products found
because this supplier's products are not listed.
Michèle Brocard, et al.,
bioRxiv - Microbiology 2021
Quote:
... Amino acids were separated using a VF-5ms inert 5% phenyl-methyl column (Agilent Technologies). The oven temperature was constant at 120 °C for 5 min ...
-
No products found
because this supplier's products are not listed.
Cindy M. Spruit, et al.,
bioRxiv - Microbiology 2022
Quote:
... nonessential amino acids (MP Biomedicals) and 20 μg/ml trypsin (Cambrex)) ...
-
No products found
because this supplier's products are not listed.
Aliza Borenstein-Katz, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 0.67% yeast nitrogen base w/o amino acids (BD), 0.54% Na2HPO4 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Jessica Tang, et al.,
bioRxiv - Genomics 2020
Quote:
... and template-switching oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” indicates a ribonucleic acid base and “+” indicates a locked nucleic acid base; Qiagen). cDNA was amplified using KAPA HiFi HotStart ReadyMix kit (Roche #KK2502 ...
-
No products found
because this supplier's products are not listed.
Delphine Burlet, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... R-5’ CAGACGCGTTTAGCCCTCCCACACATAACCAGA 3’ from pLKO.1-Blasticidin vector (Addgene #26655), and ligated after AgeI and MluI digestion and gel purification with the vector backbones ...
-
No products found
because this supplier's products are not listed.
Sébastien Meurant, et al.,
bioRxiv - Cell Biology 2024
Quote:
... The mutagenesis primers for the addition of the STOP codon at the end of the MPV17 gene from MPV17-HA plasmid (F: 5’-TAATCTAGAATGTACCCATACGATGTTC-3’; R: 5’-GAGCCGATGTGCCTTCCA-3’) were generated using the NEBaseChanger bioinformatic tool (NEB). The mutation was confirmed and the plasmids were validated using Sanger sequencing (Eurofins Discovery).
-
No products found
because this supplier's products are not listed.
Benjamin Lang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and the indicated Amino Acid Dropout mix (Clontech). Cultures were grown in 5 L flasks for 60 h ...
-
No products found
because this supplier's products are not listed.
Peng Liu, Ian P. Lapcinski, Karen H. Ashe,
bioRxiv - Biochemistry 2024
Quote:
... that recognizes amino acids 3-8 of Aβ and the Protein G Sepharose 4 Fast Flow resin (GE healthcare) (Tables 2 and 3 ...
-
No products found
because this supplier's products are not listed.
Xiyu Dong, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 2 mM amino acids (Roche), 1 nM pY71sfGFP plasmid encoding superfolder GFP (M ...
-
No products found
because this supplier's products are not listed.
Anna Gilpin, et al.,
bioRxiv - Bioengineering 2021
Quote:
... to which 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC, TCI Chemicals, Cat.# D1601), N-hydroxysuccinimide (NHS ...
-
No products found
because this supplier's products are not listed.
Yuhong Wang,
bioRxiv - Biophysics 2023
Quote:
... Radioactive amino acids are purchased from PerkinElmer. Other reagents are from Millipore Sigma if not specified ...
-
No products found
because this supplier's products are not listed.
Bradley M. Roberts, et al.,
bioRxiv - Neuroscience 2020
Quote:
... DL-2-Amino-5-phosphonovaleric acid (AP5, 50 μM), disulfiram (10 μM) and SKF-89976A hydrochloride (SKF, 20 μM) were obtained from Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Athanasios Papadas, et al.,
bioRxiv - Immunology 2021
Quote:
... 10mM non-essential amino acids and 10ng/mL IL-6 (Peprotech)] ...
-
No products found
because this supplier's products are not listed.
Shohei Yamamoto, et al.,
bioRxiv - Cell Biology 2022
Quote:
... the polystyrene beads containing surface primary amino groups (PolySciences, 17145-5, Diameter 3 μm) were incubated with 10 mM of Sulfo-NHS-LC-LC-Biotin (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Paraskevi Athanasouli, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
No products found
because this supplier's products are not listed.
Jana Hucklenbroich, et al.,
bioRxiv - Plant Biology 2021
Quote:
... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
No products found
because this supplier's products are not listed.
Yuki Kondo, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 3-amino-9-ethylcarbazole (Vector Laboratories, Inc.) was used as a substrate for visualization ...
-
No products found
because this supplier's products are not listed.
Francesco Limone, et al.,
bioRxiv - Neuroscience 2023
Quote:
... non-essential amino acids (NEAA, Stemcell technologies). After 24h (day0) ...
-
No products found
because this supplier's products are not listed.
Artyom A. Egorov, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... complete amino acid supplementation) overnight in 96-well flat bottom plates (Eppendorf), diluted into fresh medium with a dilution factor of 200 ...
-
No products found
because this supplier's products are not listed.
Rachid Essalmani, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 1% nonessential amino acids (NEAA) and 50 µg/ml blasticidin (Invivogen). The cells were transfected with JetPrime transfection reagent according to the manufacturer’s instructions (Polyplus transfection ...
-
No products found
because this supplier's products are not listed.
Bernardo Oldak, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... 1% non-essential amino acids (Biological Industries – Sartorius 01-340-1B) and 0.1 mM β-mercaptoethanol (Thermo 31350010).
-
No products found
because this supplier's products are not listed.
Jessica Brown, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Four μg of Tau12 (N-terminal [epitope = amino acids 6-18], BioLegend), HT7 (mid-region [epitope = amino acids 159-163] ...
-
No products found
because this supplier's products are not listed.
Melanie B. Abrams, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... 0.075% 5-fluorooritic acid (Zymo Research)) ...
-
No products found
because this supplier's products are not listed.
Gali Estopare Araguirang, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The output list of CandiSNP was screened for nonsynonymous amino acid changes and the G/C to A/T transitions that were likely to be caused by EMS, with a special focus on the chromosome with the highest SNP density with an allele frequency of 1 ...
-
No products found
because this supplier's products are not listed.
Leire de Campos-Mata, et al.,
bioRxiv - Immunology 2023
Quote:
... respectively) and 3 μl were kept 5 min at RT until their application onto glow-discharged holey carbon grids (Quantifoil, Au 300 mesh, R 0.6/1). The grids were blotted and then plunged into liquid ethane using a FEI Vitrobot Mark IV at 20°C and 95% relative humidity ...
-
No products found
because this supplier's products are not listed.
Jia J. Li, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Slides were rinsed in tap water and dipped 3-5 times in 0.5% Acid Alcohol (Leica Biosystems 3803651), followed by rinsing in tap water and bluing with Scott’s Tap Water (Electron Microscopy Sciences 2607007 ...
-
No products found
because this supplier's products are not listed.
Shirin Zamani-Nour, et al.,
bioRxiv - Plant Biology 2020
Quote:
... The total amino acid content was then measured in a Synergy HT plate reader (BioTek, Germany) at a wavelength of 550 nm ...
-
No products found
because this supplier's products are not listed.
Daltry L. Snider, et al.,
bioRxiv - Immunology 2022
Quote:
... R-anti-14-3-3ε (Cell Signaling Technology, 1:1000), M-anti-Flag M2 (Sigma ...
-
No products found
because this supplier's products are not listed.
Nicholas Drachman, et al.,
bioRxiv - Biophysics 2024
Quote:
We prefilled the nanopipette with the amino acid or peptide solution using a Microfil flexible needle (World Precision Instruments) before mounting the nanopipette inserting them into the mass spectrometer ...
-
No products found
because this supplier's products are not listed.
Maltais-Payette Ina, et al.,
bioRxiv - Physiology 2021
Quote:
... all amino acids were quantified using a Water Acquity UPLC system coupled to a Synapt G2-Si mass spectrometer (Waters) in tandem mode (LC-MS/MS) using the EZ:faast amino acid sample testing kit (Phenomenex, 2003). Briefly ...
-
No products found
because this supplier's products are not listed.
David S Uygun, et al.,
bioRxiv - Neuroscience 2021
Quote:
... sIPSCs were recorded at −70 mV in the presence of the glutamate receptor antagonists (20 μM 6-cyano-7-nitroquinoxaline-2,3-dione +50 μM D-(2R)-amino-5-phosphonopentanoic acid) using a Multiclamp 700B amplifier and pClamp 10.0 software (Molecular devices; California, United States). A 1 min period after 5 min application of the glutamate receptor antagonists was used for statistical analysis (Igor software ...
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
No products found
because this supplier's products are not listed.
Nioosha Nekooie-Marnany, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Cy-3 or Cy-5 (Jackson Immunoresearch Laboratories), and processed for DAPI or Hoechst staining to visualize cells’ nuclei before mounting in ImmuMount medium (Shandon) ...
-
No products found
because this supplier's products are not listed.
Áron Kőszeghy, et al.,
bioRxiv - Neuroscience 2023
Quote:
3-5 months old male C57/BL6J mice (Charles River, UK) were anesthetized with isoflurane (4% induction ...
-
No products found
because this supplier's products are not listed.
Aimee Ellison, Amara Pouv, Douglas A. Pace,
bioRxiv - Physiology 2020
Quote:
The Sfaa was determined through high performance liquid chromatography (HPLC) separation of the free amino acid pool (FAA) and liquid scintillation counting (Beckman Coulter LS 6500, Brea CA) of the alanine elution peak ...
-
No products found
because this supplier's products are not listed.
Max D. Knickmeyer, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Embryos were examined at 3-5 dpf using a stereomicroscope (Nikon SMZ18) with a light source for fluorescence ...
-
No products found
because this supplier's products are not listed.
Judith Brock, Marcel Hörning,
bioRxiv - Developmental Biology 2024
Quote:
... A silicon nitride cantilever with an attached spherical colloidal probe (CP-PNP-BSG; 0.08 N/m; R = 5 µm, Olympus Optical) was used ...