Labshake search
Citations for Takara Bio :
1 - 50 of 831 citations for R 3 Amino 5 hexynoic acid hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... and the indicated Amino Acid Dropout mix (Clontech). Cultures were grown in 5 L flasks for 60 h ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Plant Biology 2022Quote: ... The qRT-PCR was performed with the reversed cDNAs as substrates and the MeSWEET10a specific primers (F: 5’-TCCTCACCTTGACTGCGCTG-3’; R: 5’-AGCACCATCTGGACAATCCCA-3’) by using the SYBR Premix Taq Kit (TaKaRa, Dalian, China) in the ABI7500 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Cell Biology 2021Quote: ... and LIM 3 (amino acids 361-421) were cloned into the multiple cloning site of pEGFP-N3 or pEGFP-C3 (Clontech) as previously described (Sala et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... Genomic recombination assay was performed using PCR primers that flank exons 4-6 of mouse Galnt2 (F: 5’-GTACGTGAGACAGGCCTAAGG-3’ R: 5’-CAAGCTTCATTTAGGACCAAGC-3’) and EmeraldAmp PCR Master Mix (Takara Bio, San Jose, CA). PCR cycling parameters were as follows ...
-
bioRxiv - Neuroscience 2021Quote: ... AP-MDGA1 and AP-MDGA2 were generated by replacing the V5 tag of the V5-MDGA1 and V5-MDGA2 constructs respectively by the 14 amino acids AP tag (5’GGCCTGAACGAtATCTTCGAGGCCCAG AAGATCGAGTGGCACGAG3’) using the HD-In-Fusion kit (Takara). The linker 5’GGAGGATCAGGAGGATCA3’ was added after the AP tag ...
-
bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
bioRxiv - Physiology 2024Quote: ... Single amino acid mutations were introduced using PrimeSTAR Mutagenesis Basal Kit (Takara Bio Inc.). Chimeras were generated using In-Fusion HD Cloning Kit (Takara Bio Inc.) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and glyceraldehyde 3-phosphate dehydrogenase (5′-GCACCGTCAAGGCTGAGAAC-3′ and 5′-TGGTGAAGACGCCAGTGGA-3′; Takara Bio Inc., Shiga, Japan) were used for RT-PCR.
-
bioRxiv - Immunology 2022Quote: 5’ and 3’ RACE was performed with SMARTer RACE 5’/3’ Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... reverse primer (5’-caccgccatggtggcggatcccttgtacagctcgtccatgcc −3’) (Clontech).
-
bioRxiv - Neuroscience 2024Quote: ... reverse primer (5’-cacgtctcatcccctccatctttgacctttcaaagtg - 3’) (Clontech). The full-length Tenm4 cDNA ...
-
bioRxiv - Biochemistry 2020Quote: ... The DHTKD1 open reading frame (amino acids 25-919) was amplified using PrimeSTAR GXL DNA Polymerase (Takara) and primers forward (5’-GGT TTA GAA TTC ATG CAG ACC GAG CGG GGC GTT TA-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... The sequence encoding amino acids 2-1273 were cloned into a shuttle plasmid following InFusion cloning (Clontech). The shuttle plasmid encodes a modified human cytomegalovirus major immediate early promoter (IE CMV ...
-
bioRxiv - Cell Biology 2020Quote: Murine GFP-CIZ1 (845 amino-acids) and GFP-CIZ1Δ2p6p8 (formerly known as ECIZ1) in pEGFP-C3 (Clontech) were described previously (Coverley et al. ...
-
bioRxiv - Microbiology 2023Quote: ... and double amino acid mutations were introduced using PrimerSTAR® Max DNA Polymerase (# R046A, Takara Bio Inc.). The primers used for the mutation generation were listed in SI data.
-
bioRxiv - Physiology 2022Quote: ... 5’-RACE was performed by SMARTer RACE 5’/3’ kit (Clontech) by manufacture protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’ RACE was performed using the SMARTer 5’/3’ kit (TAKARA) with slight modifications ...
-
bioRxiv - Cell Biology 2020Quote: ... from second to third - 5’-ttgaattcgcgctttgtgagcattgc-3’ and 5’-ttgtcgacgttgtcgtccgtgtgcac-3’ and then subcloned into pGAD424 vector (Clontech) in frame with activation domain of GAL4 using restriction sites EcoR1 and Sall.
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid called “CFP-Golgi” (containing amino acids 1–81 of ß-1,4glycosyltransferase) was originally purchased from Clontech.
-
bioRxiv - Cell Biology 2020Quote: The N-terminal domain of dTBCE (amino acid 1 to 207) was cloned using the Infusion system (Takara) into pET23B (Clontech ...
-
bioRxiv - Biochemistry 2020Quote: One colony was used to inoculate 10mL of selection media (6.9 g/L Yeast Nitrogen Base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Biochemistry 2020Quote: ... Transformed cells were plated on a selection agar (6.9g/L yeast nitrogen base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-ctcgagtgcggccgcaagcttgctcatgacgctgccacggtg-3’ using PrimeSTAR HS (Takara). The pET28a was digested at NdeI and HindIII sites ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-cagtggtggtggtggtggtgctcgagtcaacacctggcgttgaccg-3’ using PrimeSTAR HS (Takara). The pET28a-MBP was digested at BamH1 and XhoI sites ...
-
bioRxiv - Immunology 2022Quote: ... the SMARTer RACE 5’/3’ Kit (Takara) was used following manufacturer’s protocol and using the following primer ...
-
bioRxiv - Microbiology 2021Quote: ... a SMARTer RACE 5’/3’kit (Takara) was used ...
-
bioRxiv - Developmental Biology 2023Quote: SMARTer RACE 5’/3’ Kit from Takara Bio was used following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: The 5’ and 3’ ends of Cpun_dsx were amplified using the SMARTer RACE 5’/3’kit (TaKaRa, Shiga, Japan) and gene-specific primers designed for OD2 (“Cpun_dsx OD2 5’RACE” and “Cpun_dsx OD2 3’RACE” ...
-
bioRxiv - Cell Biology 2021Quote: ... The HBV core protein coding region was amplified using the forward primer 5’-ATCATAAGCTTACCATGGACATCGACCCTTATAAAG-3’ and reverse primer 5’-TAGATGGTACCCTAACATTGAGGTTCCCGAG-3’ and subcloned into the pcDNA3.1 vector (Clontech) via HindIII and KpnI restriction sites ...
-
bioRxiv - Cancer Biology 2022Quote: ... using 5′-GGGTTAGGGATAGGCTTAC-CACCGGTTTACTTGTACAGCTCGTCCATGC -3′ and 5′-CTTGTACAAAGTGGTTACCGGAGGATC-CGGTGGTGTGAGCAAGGGCGAGGAGCTG -3′ primers for PCR and In-Fusion Cloning (Takara Bio). The pStrep-ANKLE1 plasmid was obtained by cloning annealed oligonucleotides containing Twin-Strep-tag (5′ CCGGTCACCATGGCGTGGAGCCACCCGCAGTT-CGAGAAAGGTGGAGGTTCCGGAGGTGGATCGG-GAGGTTCGGCGTGGAGCCACCCGC-AGTTCGAAAAAGC 3′ and 5′ GGCCGCTTTTTCGAACTGC-GGGTGGCTCCACGCCGAACCTCCCGAT-CCACCTCCGGAACCTCCACCTTTCTCGAA-CTGCGGGTGGCTCCACGCCATGGTGA 3′ ...
-
bioRxiv - Microbiology 2024Quote: ... 5’ and 3’-ends of RBK21 cDNA were analyzed using 5’-Full and 3’-Full RACE core sets (TAKARA) with specific primers (Extended Data Table 8) ...
-
bioRxiv - Molecular Biology 2022Quote: 5’ RACE was performed using SMARTer RACE 5’/3’ Kit (TAKARA #634858) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... MEM (supplemented with non-essential amino acids) from HiMedia (India) and Tet system approved FBS was obtained from Takara Bio USA ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... A plasmid encoding the G protein chimera GqGi3 bearing the core of human Gαq and the last 4 amino acid of Gαi3 was generated by primer mutagenesis and In-Fusion HD Cloning (Clontech) in a pcDNA3.1 vector ...
-
bioRxiv - Cell Biology 2020Quote: The full-sized Not (aa 496) was PCR-amplified using primers 5’-ttgaattcatgtccgagacgggttgtc-3’ and 5’-ttgtcgacttactcgtattccagcacatt-3’ and subcloned into pGBT9 vector (Clontech) in frame with DNA-binding domain of GAL4 using restriction sites EcoRI and Sal1.
-
bioRxiv - Cell Biology 2020Quote: The full-sized CP190 (aa 1096) was PCR-amplified using primers 5’-ttcccgggcatgggtgaagtcaagtccg-3’ and 5’-tttggaggagctatatttactaagatct-3’ and subcloned into pGAD424 vector (Clontech) in frame with activation domain of GAL4 using restriction sites SmaI and BamHI ...
-
bioRxiv - Genomics 2020Quote: ... 10 μL of which was subject to PCR with primer pair 5′- AATGATACGGCGACCACCGAGATCT-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ and 5′-CAAGCAGAAGACGGCATACGAGAT-CTGATC-TGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-GCTGCGCTCGATGCAAAATA-3′ using PrimeSTAR Max PCR master mix (R045A, Takara) to add sequencing adapter sequences to CASB barcode.
-
bioRxiv - Developmental Biology 2020Quote: ... mCherry cDNA was amplified using primers NheI mCherry Fw (5’-acgctagctatggtgagcaagggcgaggag-3’) and XhoI mCherry Rv (5’-gactcgagttacttgtacagctcgtccat-3’) from mCherry Vector (Clontech), and then the product was introduced into NheI-XhoI sites of the pFRT-SV40-FRT vector (Gift from Elizabeth R ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR amplification was carried out with primers (Forward: 5’-AGGCAGTGAGTGAAGTGT -3’, Reverse: 5’-TAAGTTGGCGAGGCTTGA -3’) using PrimeSTAR HS DNA Polymerase (DR010A, Takara) under the following conditions ...
-
bioRxiv - Biophysics 2022Quote: ... 5’ and 3’-RACE-Ready cDNA templates were synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 5’ and 3’ end sequences of P ...
-
bioRxiv - Neuroscience 2021Quote: ... the promoter pgrd-10 was amplified from fosmid WRM0612bC07 using 5’-ccatgattacgccaatcgtcatc-3’ and 5’-tggccaatcccggggtttttaga-3’ and cloned with Gateway backbone amplified using 5’-ccccgggattggcca-3’ and 5’-ttggcgtaatcatgg-3’ to make pgrd-10∷GW [pNBRGWY151] using infusion cloning(Takara). It was then recombined with ced-10 WT[pNBRGWY88] using LR recombination (Invitrogen).
-
bioRxiv - Molecular Biology 2023Quote: ... and those targeting the Alu repeat sequence in the nuclear genome (5′-CTTGCAGTGAGCCGAGATT-3′ and 5′- GAGACGGAGTCTCGCTCTGTC-3′) (75) with TB Green Premix Ex Taq II (TaKaRa) on Thermal Cycler Dice Real Time System II (TaKaRa) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We amplified a 1.4 kb genomic fragment with PCR primers AIP3F (5’- GGCGCTATACCCGCTCGTGTCC-3’) and AIP5R2 (5’-CTTCATATTTGAAGACGAGGGAGG-3’) using 10 ng genomic DNA and Advantage DNA polymerase (Clontech) with the following cycling conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... was PCR-amplified with the primer set (fwd: 5’- CTTCGAATTCTGGCCACCATGGCTGCCGCCACCACC-3’, rev: 5’- CGGTGGATCCccCAAGAAATCCTTGATGTTAAGATCCGCTAATGG-3’) and inserted into EcoRI and BamHI sites of pmCherry-N1 (Clontech) by restriction digestion and T4 ligation ...
-
bioRxiv - Microbiology 2023Quote: ... The V1-V2 variable region of stool DNA was amplified by universal primer set 27F-mod (5’-AGRGTTTGATYMTGGCTCAG-3’) and 338R (5’-TGCTGCCTCCCGTAGGAGT-3’) using Gflex DNA polymerase (Takara) 37 ...
-
bioRxiv - Neuroscience 2024Quote: ... Full-length of itga2 was inserted into the Sfi IA (5′-GGCCATTACGGCC-3′) and Sfi IB (3′-GGCCGCCTCGGCC-5′) sites of the “prey” pPR3-C vector (Clontech). Series of combinations of bait and prey constructs were cotransformed into the yeast strain NMY51 (Clontech) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: Adult ovary total RNA was used to amplify the 5’ and 3’ UTR of Pxmeiw68 and PxnanosP using the SMARTer RACE 5’/3’ Kit (Takara, Japan). 5’ and 3’ regulatory sequences were then cloned from 4th instar larval gDNA ...
-
bioRxiv - Evolutionary Biology 2021Quote: First amplified with primers 27F (5’-AGAGTTTGATCMTGGCTCAG-3’) and 1492R (5’-GGTTACCTTGTTACGACTT-3’) using EmeraldAmp GT PCR Master Mix (TAKARA BIO) to minimize the amplification of non-bacterial taxa under the following cycling conditions ...