Labshake search
Citations for PerkinElmer :
1 - 50 of 673 citations for R 3 Amino 5 hexynoic acid hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... Radioactive amino acids are purchased from PerkinElmer. Other reagents are from Millipore Sigma if not specified ...
-
bioRxiv - Systems Biology 2023Quote: ... Free amino acids were determined with the EZ:FAAST amino acid analysis kit of Phenomenex on a GC-FID (Perkin Elmer) according to supplier instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The 14C-labeled amino acid of interest (Perkin Elmer, MA, USA) was added to the cells to a final concentration of 1 µM with stirring ...
-
bioRxiv - Microbiology 2021Quote: ... and 20 μM [3H]-amino acid (Perkin Elmer, 7.5 Ci/mmol) in a buffer containing 20 mM KCl ...
-
bioRxiv - Biochemistry 2023Quote: ... and the uptake reactions were started by adding radiolabeled amino acid (PerkinElmer). For the uptake assays by PUT4 variants ...
-
bioRxiv - Plant Biology 2020Quote: ... were translated in WGE in a total volume of 12.5 µl with amino acids mixture or [35S]-methionine amino acid mixture (Ct= 3.06 μCi/0.14 MBq, 5.8 Ci/mmol, Perkin Elmer), 93 mM potassium acetate ...
-
bioRxiv - Biochemistry 2023Quote: ... in the presence of 20 µM of the corresponding L-[14C]-amino acid (Perkin Elmer). AaRSs were diluted in 100 mM HEPES-KOH pH 7.5 ...
-
bioRxiv - Physiology 2022Quote: ... with 0.33mM R,S-[2-14C]mevalonic acid (53mCi/mmol; Perkin Elmer) hydrolysed from the lactone form ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5 μCi L-[U-14C]aspartic acid (0.1 mCi/mL, PerkinElmer) was added to each plate ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... the samples were diluted into 5% nitric acid and 1% hydrochloric acid and tested on the PerkinElmer NexION 300D (PerkinElmer, Inc.). A calibration curve with known Au concentrations was prepared and the Au concentration was determined according to absorbance values ...
-
bioRxiv - Immunology 2020Quote: ... TSA Cyanine 3 or Cyanine 5 amplification kits (Perkin Elmer) were used according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... TSA fluorophores for cyanine 3 and cyanine 5 (Perkin Elmer) were used at a concentration of 1:1000 ...
-
bioRxiv - Microbiology 2023Quote: The ROS production by macrophages was measured by chemiluminescence in the presence of 5-amino-2,3-dihydro-1,4-phthalazinedione (luminol) using a thermostatically (37°C) controlled for 1 hr (Envision, PerkinElmer). For nitrite release ...
-
bioRxiv - Cell Biology 2022Quote: ... for 5 min in a VICTOR 3 microplate reader (Perkin Elmer). The results were expressed as % of the pool of controls.
-
bioRxiv - Developmental Biology 2020Quote: ... Cyanine 3 (Cy3) or Cyanine 5 (Cy5) Fluorophore Tyramide by PerkinElmer was used ...
-
bioRxiv - Genomics 2020Quote: ... and 1 μCi of [α-32P]-3’-deoxyadenosine 5’-triphosphate (cordycepin 5’-triphosphate, Perkin Elmer Life Sciences) in 1× terminal deoxynucleotidyl transferase buffer (New England Biolabs) ...
-
bioRxiv - Cell Biology 2020Quote: Fully differentiated C2C12 MS2-CAS myotubes were starved in serum-and glucose-free DMEM for 2 hrs before a 3-hr incubation in low-glucose DMEM/fatty acid-free BSA 0.2% supplemented with radiolabeled glucose (Glucose, D-[3-3H]; 1 μCi/ml; PerkinElmer). Then ...
-
bioRxiv - Cell Biology 2022Quote: ... at 37°C for 5 min in a VICTOR 3 microplate reader (Perkin Elmer). Results were expressed as % of the pool of controls.
-
bioRxiv - Cancer Biology 2020Quote: ... The reverse primer R3 (5′-GCGCCGGTAGTTGCCCTTCTC-3′) was labeled at the 5′ end using [γ-32P]-ATP (PerkinElmer Inc., Waltham, MA, USA) and T4 polynucleotide kinase (Takara) ...
-
bioRxiv - Biochemistry 2021Quote: Structural models of polyenoyl tetramic acids 3 and 4 were built and energy minimized using Chem3D v.16.0 (Perkin Elmer). The terminal region of polyenes ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 minutes after intraperitoneal injection of Potassium D-Luciferin solution (Perkin Elmer, 3 mg/mouse). Luminescence values for all xenografts were quantified as the average radiance (photons/s/cm2/sr ...
-
bioRxiv - Developmental Biology 2021Quote: ... The amplification was carried out using the TSA Plus Cyanine 3/5 System (Perkin Elmer). The probe SP72-Bmp4 and Bmp2 were provided by Severine Urfer ...
-
bioRxiv - Microbiology 2024Quote: Overnight cultures were diluted to an OD600 of ∼0.05 in 10 mL LB Miller broth supplemented with 5 µCi/mL 32P ortho-phosphoric acid (PerkinElmer) and grown until reaching an OD600 of ∼0.6 ...
-
bioRxiv - Neuroscience 2020Quote: ... The receptor autoradiography procedure was performed using a linear V1a-R antagonist [125I]-d(CH2)5(Tyr[Me])-AVP (Perkin Elmer, USA) or a linear OXTR antagonist [125I]-d(CH2)5[Tyr(Me)2-Tyr-Nh2]9-OVT (Perkin Elmer ...
-
bioRxiv - Neuroscience 2020Quote: ... as well as Cyanine 3 Tyramide Reagent and Cyanine 5 Tyramide Reagent and Fluorescein Tyramide Reagent (all PerkinElmer), respectively ...
-
bioRxiv - Genomics 2020Quote: ... 3 times 5 min washes with TNT and signal amplification for 8 min using Cy3 (NEL704A001KT, Perkin Elmer) 1:50 in amplification diluent ...
-
bioRxiv - Pathology 2023Quote: 14C-labeled palmitic acid (C16) and 14C-octanoic acid (C8) were from PerkinElmer while 14C-DC12 and 14C-lignoceric acid (C24 ...
-
bioRxiv - Physiology 2024Quote: ... A mixture of 14C-oleic acid (Oleic Acid, [1-14C]-, NEC317050UC, Perkin Elmer) and fatty acid free and endotoxin free bovine serum albumin (A8806-1G ...
-
bioRxiv - Cancer Biology 2022Quote: Mouse orthotopic xenograft models (4-5 mice per each group) were intravenously injected with 14C-acetate (3 μCi, PerkinElmer) in 200 μL saline and perfused with 4% paraformaldehyde (PFA ...
-
bioRxiv - Developmental Biology 2024Quote: ... The RNAscope Multiplex Fluorescent Detection Reagents v2 and the TSA Plus Cyanine 3 and 5 fluorophore (Perkin Elmer, NEL744001KT) were applied according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... [14C]-palmitic acid (Perkin Elmer) was added to a final activity concentration of 0.2 μCi/mL ...
-
bioRxiv - Neuroscience 2020Quote: ... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 and 6 hr later cells were labeled for 5 min with 1 mCi/ml 35S Protein Labeling Mix (PerkinElmer). Lysates from 25-ml culture triplicate samples were analyzed by SDS-PAGE and autoradiography.
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Physiology 2020Quote: ... [9,10-3H(N)]-oleic Acid (PerkinElmer) or n-[2,2’,3,3’-3H] octanoic acid (American Radiolabeling Chemicals ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Pathology 2023Quote: ... as previously described [71] using Multiplex Fluorescent Reagent Kit V2 (Advanced cell Diagnostics) and TSA Plus Cyanine 3 and Cyanine 5 (Perkin Elmer) as fluorophores according to manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fluorescently labeled RNA was obtained by replacing 1/4 volume of CTP with Cyanine 3-CTP (Cy3-CTP) or Cyanine 5-CTP (Cy5-CTP) (PerkinElmer NEL581001EA) in the in vitro transcription reaction.
-
bioRxiv - Microbiology 2022Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [α32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were washed 3 times for 5 min in TBS-T buffer and prior to chemiluminescence detection using Western Lightning chemiluminescent substrate (Perkin Elmer). Chemiluminescence signal was detected with an ECL-Imager (INTAS ...
-
bioRxiv - Biophysics 2023Quote: ... stand and a 40 nt oligo-dT at the 5′ end was labeled at the 3′ terminus with [α-32P] dCTP (Perkin Elmer) and annealed to the single-stranded DNA M13mp18(24) ...
-
bioRxiv - Pathology 2022Quote: Fatty acid uptake and incorporation into lipids as well as de novo lipogenesis were determined using [9,10-3H(N)]-oleic acid and [1,2-14C]-acetic acid (PerkinElmer), respectively ...
-
bioRxiv - Microbiology 2023Quote: Measurements of fatty acid biosynthesis were performed by measuring the incorporation of (1-14C) acetic acid (Perkin Elmer) into cellular lipids as described previously(Spencer et al. ...
-
bioRxiv - Physiology 2021Quote: ... 4.5µCi 3H-oleic acid (NET289001MC, Perkin Elmer), was dried down under N2 then resuspended in PBS and combined 1:1 with 40% fatty-acid free bovine serum albumin to a final volume of 200µl ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... on a Chemagic360 nucleic acid extractor (PerkinElmer) with a 96-well rod head after samples were homogenized using a steel ball in lysis buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... [U-14C]palmitic acid (Perkin Elmer, NEC534050UC), 100 µM cold palmitic acid (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... [2-14C] acetic acid (Perkin Elmer, NEC553050UC) and 50 µM cold acetic acid (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2020Quote: ... The 3’TAMRA fluorescence from 5’UAR was recorded by a single molecule avalanche photodiode (SPAD) (SPCM-AQR-14, PerkinElmer Optoelectronics, Quebec, Canada), through a 600/50 band pass emission filter ...
-
bioRxiv - Cell Biology 2020Quote: ... subconfluent HDLECs cultured in 12-well plates were incubated with 1 ml per well EBM2 medium (containing appropriate amounts of BSA, carnitine, and cold palmitic acid) with [9,10-3H]-palmitic acid (Perkin Elmer) for 6 hours ...