Labshake search
Citations for New England Biolabs :
1 - 50 of 3048 citations for R 3 Amino 5 hexynoic acid hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... The mutagenesis primers for the addition of the STOP codon at the end of the MPV17 gene from MPV17-HA plasmid (F: 5’-TAATCTAGAATGTACCCATACGATGTTC-3’; R: 5’-GAGCCGATGTGCCTTCCA-3’) were generated using the NEBaseChanger bioinformatic tool (NEB). The mutation was confirmed and the plasmids were validated using Sanger sequencing (Eurofins Discovery).
-
bioRxiv - Cancer Biology 2024Quote: ... 1X Non-Essential Amino Acids (NEAA, #SH30238.01, Nordic Biolabs), 2mM L-Serine (#S4311 ...
-
bioRxiv - Genetics 2021Quote: ... two complementary oligos containing the guide sequence and a BbsI recognition site (Oligo F: 5’CACCGNNNNNNNNNN….3’ and Oligo R: 5’AAACNNNNNNNNNN…..C3’) were annealed and cloned into the BbsI (NEB) digested target plasmid.
-
bioRxiv - Immunology 2021Quote: ... were generated by introducing the corresponding amino acid mutations (Extended Data Fig. 5) using the Q5® Site-Directed Mutagenesis Kit (NEB) and per manufacturer’s protocol.
-
bioRxiv - Bioengineering 2020Quote: ... Single amino acid substitutions were introduced utilizing the KLD Enzyme Mix (NEB) following PCR amplification with mutagenic primers (Genewiz) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’-hydroxyl (5’HO-RNA30-FAM-3’) or 5’-Gppp (5’Gppp-RNA30-FAM-3’) in 1x NEBuffer 3 (NEB; B7003), in 20% denaturing polyacrylamide gels ...
-
bioRxiv - Plant Biology 2021Quote: ... Amino acid substitutions were generated with the Q5 site-directed mutagenesis kit (NEB) with specific primers (Supplemental Table 4) ...
-
bioRxiv - Microbiology 2024Quote: ... Individual amino acid point mutants were generated using a Q5-SDM kit (NEB) using the B1 variant as template.
-
bioRxiv - Molecular Biology 2021Quote: ... R: 5’-ccgggaaaaactgaaaaaccattggcacgacaggtttcccgac-3’ from the pKAM555 vector) was inserted at the ClaI site using HiFi assembly (NEB). For the intTEL0 strain creation the pUC19LG plasmid (lacking the PstI(blunted)-BclI fragment of the HARS36 sequence ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Bioengineering 2022Quote: ... and single amino acids were made by KLD site directed mutagenesis (New England Biolabs). Rotavirus antigens were designed based on optimized sequences described previously ...
-
bioRxiv - Biochemistry 2023Quote: ... Amino acid substitution mutants were prepared using the Q5 mutagenesis method (New England Biolabs) with oligonucleotides from IDT ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μL Klenow fragment (3’→5’ exo-) (NEB), and 9 μL of DEPC H2O to each reaction and incubating at 37 °C for 30 min ...
-
bioRxiv - Systems Biology 2024Quote: ... and 3 μL of Klenow 3’ to 5’ exo (5 U/μL, NEB), and samples were incubated in a thermocycler at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... separated by the SIM sequence (amino acids 469-478) going outwards using Q5 polymerase (NEB). PCR product was purified ...
-
bioRxiv - Plant Biology 2023Quote: ... and MpERF20 cds in situ R (5’ GTACAAGAAAGCTGGGTCGGCGCGCCttacatgagtgggggaactaaaagaagagt-3’) and seamlessly cloned using NEBuilder HiFi DNA Assembly (New England Biolabs, #E5520) into pENTR-D linearized with NotI/AscI ...
-
bioRxiv - Molecular Biology 2021Quote: ... Customized PURExpress reconstituted systems lacking all amino acids and release factors (Δaa, ΔRF123) (New England Biolabs) (Fig ...
-
bioRxiv - Biochemistry 2024Quote: ... Single amino acid substitutions were introduced using NEB’s site-directed mutagenesis kit (New England Biolabs, E0552S). Primers used for cloning and site-directed mutagenesis are listed in Table S2 ...
-
bioRxiv - Microbiology 2022Quote: ... a custom 3’ adapter (5’-rAppCTGTAGGCACCATCAAT–NH2-3’, NEB, S1315S) was ligated to all RNAs ...
-
bioRxiv - Systems Biology 2021Quote: ... the purified DNAs were annealed using random nonamer primers with a 5′-biotin tag (5′-Biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′) in the presence of Klenow fragments (3′-5′ exo-, New England Biolabs). Then ...
-
bioRxiv - Cancer Biology 2023Quote: ... Pu TKamplicon (5’-CTGTTTTCATTCTGCCTTTTGACCATAGAGCCCACCGCATCC-3’ and 5’-GCCAACAAAGAAAGCCTCACTACC GGGTAGGGGAGGCG -3) and Gibson Assembly master mix (NEB) following the manufacturer’s guidelines.
-
bioRxiv - Bioengineering 2021Quote: 3 μL of 5′-deadenylase (NEB) were added to ligation reaction,
-
bioRxiv - Genomics 2023Quote: ... Klenow Fragment (3’→5’ exo-) (NEB) was diluted in 1X NEBuffer 2 to a final concentration of 2 U/μL ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 units of Klenow Fragment (3’à 5’ exo-, NEB), CutSmart buffer (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µl of Klenow Fragment (3′→5′ exo-, NEB, M0212S), 3 µl of T4 polynucleotide kinase (NEB ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5’-CCTGACATGCCTGATCCTCT-3’) and exon 5 (5’-GTGTTCTTACCACCTCCCC-3’) with Q5 high-fidelity hot-start polymerase (NEB # M0493L). Thermocylcing parameters were as follows ...
-
bioRxiv - Cancer Biology 2024Quote: ... After signal detection membranes were stripped and re-hybridized overnight at 50 °C with oligonucleotides detecting β-actin (5’-GTGAGGATCTTCATGAGGTAGTCAGTCAGGT-3’) and U6 (5’-GGAACGCTTCACGAATTTGCGT-3’) 5’-end labeled with T4 polynucleotide kinase (New England Biolabs) and [γ-32P]ATP ...
-
bioRxiv - Biochemistry 2023Quote: ... or amino acid substitutions was carried out using the Q5 DNA polymerase and KLD enzyme mix (NEB). Plasmid DNA was extracted and purified from 5 ml or 250 ml bacterial culture using Miniprep (Qiagen ...
-
bioRxiv - Biochemistry 2024Quote: ... Truncated EndoS1 lacking the first 9 amino acids was created by Q5 mutagenesis (New England Biolabs, NEB) by amplifying the full-length construct using primer pairs P154/P155 ...
-
bioRxiv - Biochemistry 2024Quote: ... Truncated EndoS1 lacking the first 9 amino acids was created by Q5 mutagenesis (New England Biolabs, NEB) by amplifying the full-length construct using primer pairs P154/P155 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µ l of Klenow Fragment (3’→5’ exo-, NEB, M0212S) 3µl of T4 Polynucleotide Kinase (NEB ...
-
Competition co-immunoprecipitation reveals interactors of the chloroplast CPN60 chaperonin machinerybioRxiv - Molecular Biology 2023Quote: ... with oligos 5’-GGTGGTTGCTCTTCCAACGCTGACGCTAAGGAGATTGTG-3’ and 5-GGTGGCATATGTTAGATGGTCATGCCGGAGG-3’ and cloned with SapI and NdeI into Tyb21 (NEB), giving pFW38 ...
-
bioRxiv - Biochemistry 2020Quote: ... Amino acid substitutions were made using the Q5 Site-directed Mutagenesis kit (New England Biolabs, Ipswich, MA, USA) to generate pNG309 and pNG307 for expression of xoxF1 D320A and exaF D319S ...
-
bioRxiv - Genetics 2022Quote: ... or FLAG (amino acid sequence: DYKDDDDK) with a kit (Gibson assembly kit from New England Biolabs, catalogue # E5510S). The different combinations were cloned into pJFRC7-20XUAS-IVS-mCD8::GFP (Addgene # 26220 ...
-
bioRxiv - Microbiology 2022Quote: ... Amino acid substitutions in pCDNA3-HA-CoV2-Nsp1 vector were introduced using Phusion PCR mutagenesis (New England Biolabs) to generate pCDNA-HA-CoV2-Nsp1(R99A ...
-
bioRxiv - Genetics 2021Quote: ... 10μl Klenow (3’-5’ exo-) (M0202L, NEB), and 420μl H2O with 1 hr incubation at room temperature and then subjected to proximity ligation by adding 200μl 5× ligation buffer (B6058S ...
-
bioRxiv - Biochemistry 2020Quote: ... Klenow 3’ to 5’ exo (NEB: M0212) and Biotin-11-dUTP (40 μM ...
-
bioRxiv - Genetics 2022Quote: ... with Klenow fragment (3’-5’ exo-; NEB). Hybridization signals were obtained using Typhoon FLA 7000 (GE Healthcare ...
-
bioRxiv - Immunology 2024Quote: ... and Klenow Fragment (3’-5’ exo-) (NEB) and mixed by gentle tapping ...
-
bioRxiv - Microbiology 2022Quote: ... and a 956 bp fragment of omp-pst2 gene was amplified using the primers OmpPst2_F4qs (5’-ATTATTCGCGGCGGGTGTTAC-3’) and OmpPst2_R4qs (5’-CAGCGGCCATATTCTTGTTGA-3’) using the Q5 High-Fidelity DNA Polymerase (New England BioLabs). The PCR program consisted in an initial step at 98°C for 5 min ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1 μl of 10mM dATP and 3 μl of 5 U/μl Klenow fragment 3’ -> 5’ exo- (NEB M0212) in the thermocycler with the following program ...
-
bioRxiv - Microbiology 2022Quote: ... Briefly 5 µg pAc CrPV 5’UTR-1A-GFP-3’ or pCrPV-3 plasmids were linearized with Eco53KI (NEB) or 5 µg pTOPO dsRNA plasmids with EcoR1 (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... pCMV-hnCoV-S-H501Y-Δ69/70 was obtained from pCMV-7.1-hnCoV-S-H501Y (forward: 5’-TCCGGCACAAACGGCACA-3’, reverse: 5’-GATGGCGTGGAACCATGTC-3’) via Q5 SiteDirected Mutagenesis Kit (NEB). All plasmids were confirmed by gene sequencing (BGI Beijing) ...
-
bioRxiv - Microbiology 2023Quote: ... PM (5’-GACCCCGTTGACAGCG-3’) and PMrev (5’-TGGAACACCTGGCGGAAA-3’) with T4 polynucleotide kinase (0.075 U/µL) (New England Biolabs) and [g32P]-ATP (3000 Ci/mmol ...
-
bioRxiv - Bioengineering 2024Quote: ... 5’-AGCTACCGACAACAACGTGT-3’ and Cap9_ Kpn/Age_Rev: 5’-AGAAGGGTGAAAGTTGCCGT-3’ and Phusion High-Fidelity PCR kit (New England Biolabs). The amplicon was gel purified digested with KpnI ...
-
bioRxiv - Biochemistry 2021Quote: ... 70 and 80 amino acids deletion mutants were carried out with the Q5 mutagenesis kit (New England Biolabs, MA). All AtAtm3 constructs were overexpressed in Escherichia coli BL21-gold (DE3 ...
-
bioRxiv - Biochemistry 2023Quote: ... Single or multiple amino acid mutations in full-length GPR161 were generated using Q5 site-directed mutagenesis kit (NEB).
-
bioRxiv - Biophysics 2023Quote: ... Single-amino acid exchanges were generated by Q5® site-directed mutagenesis (New England Biolabs GmbH, Frankfurt am Main) using the appropriate primer pairs which were designed by using NEBaseChanger ...
-
bioRxiv - Cell Biology 2020Quote: ... Renilla luciferase was PCR amplified from pMT-DEST48-FLP 31 with Renilla Luciferase Forward: 5’-TGGAAGCTTGGCATTCCGGTACTGTTGGTAAAGCCACCATGACTTCGAAAGTTTATG-3’ and Renilla Luciferase Reverse: 5’-TGGAAGCTTTTATTATTGTTCATTTTTGAGAAC-3’ and digested with HindIII (NEB). Renilla luciferase was then ligated into pGL3-Control digested HindIII (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 3’ adapter (RNA oligo: 5’P-GAUCGUCGGACUGUAGAACUCUGAAC-3’InvdT) was pre-adenylated prior to use (5’ DNA adenylation kit, NEB, according to the manufacturer’s instructions) ...