Labshake search
Citations for Eppendorf :
1 - 50 of 588 citations for R 3 Amino 5 hexynoic acid hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... complete amino acid supplementation) overnight in 96-well flat bottom plates (Eppendorf), diluted into fresh medium with a dilution factor of 200 ...
-
bioRxiv - Microbiology 2023Quote: ... Following centrifugation at 12000 r/min for 5 min using a Centrifuge 5415 R (Eppendorf), the HPLC analysis was performed on the supernatant ...
-
bioRxiv - Cell Biology 2020Quote: ... for 5 min at room temperature (Eppendorf Centrifuge 5427 R). Columns were washed with 65 µl elution buffer (5% ammonia solution in water) ...
-
bioRxiv - Physiology 2020Quote: ... with 3 mM Tris(2-carboxyethyl)phosphine hydrochloride(TCEP-HCl) (Thermo Pierce) while shaking at 600 rpm in a thermomixer (Eppendorf). Samples were alkylated with 9 mM iodoacetamide (22 °C ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 5 mL overnight cultures were pelleted using a 5810-R centrifuge (Eppendorf) at 800 x g for 5 minutes ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4°C for 5 minutes (Eppendorf centrifuge 5810 R, Rotor S-4-104). Cell pellets were washed with 5 mL D-PBS and centrifugation was repeated ...
-
bioRxiv - Microbiology 2024Quote: ... via centrifugation (5-10 min, 3220 rcf, 4°C, Centrifuge 5810 R; Eppendorf). Then the pellet was resuspended thoroughly in ice-cold 1xPBS and fixed by 1:1 dilution in ice-cold absolute ethanol ...
-
bioRxiv - Cancer Biology 2024Quote: ... The fractions are then spun at 300xg for 5 minutes (Eppendorf 5804 R) at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Microbiology 2023Quote: ... the fermentation broth was centrifuged at 9000 r/min for 3 min (Eppendorf Centrifuge 5424, Germany), and the resultant pellet was collected for bacterial DNA extraction using the FastDNA® Spin Kit for Soil (MP Biomedicals ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The grown cultures were pelleted using a centrifuge (Eppendorf, 5804 R; 5000 RPM, 22°C, 3 min), washed and re-suspended in 0.8% sterile NaCl solution ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... Each culture was centrifuged for 5 min at 7,000 rpm in a benchtop centrifuge (5424 R, Eppendorf). The bacterial pellets were resuspended in approximately 100 µL media ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 0.003% Tricaine (ethyl-3-aminobenzoate-methanesulfonate) for 60 min at 31 °C in a Thermomixer (Eppendorf, Thermomixer R) set to 100 rpm ...
-
bioRxiv - Microbiology 2020Quote: ... and subjected to low-speed centrifugation at 20 × g for 5 min (Centrifuge 5810 R, Eppendorf, Hamburg, Germany) to eliminate gross particulate material ...
-
bioRxiv - Microbiology 2024Quote: ... Each 9 mL suspension was centrifuged at 9,000 × g for 5 min (Centrifuge 5810 R, Eppendorf, Hamburg, Germany). DNA extraction was performed from the pellet using the GeneJET Genomic DNA Purification Kit (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... The samples were centrifuged for 5 min at 25001 relative centrifugal force (Centrifuge 5427 R, Eppendorf; Hamburg, Germany). Every sample was diluted 1:100 in 1% HNO3.
-
bioRxiv - Genomics 2020Quote: ... (Eppendorf, 5430 R), and resuspended in 200 μL of ice-cold 1x PBS and briefly vortexed to mix the cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were vigorously vortex-mixed for 3 min and centrifuged at 14,000 rpm for 10 min at 4 °C (Eppendorf 5804 R). The clear supernatant was then transferred to a separate vial ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were kept at 37°C and 5% CO2 in a Galaxy 170 R humidified incubator (Eppendorf, Hamburg, Germany). All used cell lines were confirmed to be mycoplasma free by using MycoAlert Mycoplasma Detection Kit (Lonza).
-
bioRxiv - Cell Biology 2022Quote: ... protease and phosphatase inhibitors and PMSF (10 minutes on ice) and centrifuged at 13,300 rpm for 5 min at 4OC (Centrifuge 5810 R; rotor A-4-81; Eppendorf). The supernatant (whole cell lysates ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Homogenates were centrifuged at 1000 rpm for 5 min at 4°C in a table centrifuge (5424 R, Eppendorf, Germany). The supernatant was transferred to a new tube and again centrifuged at 4°C for 5 min at 1400 rpm ...
-
bioRxiv - Cell Biology 2022Quote: All cells were kept at 37°C and 5% CO2 in a Galaxy 170 R humidified incubator (Eppendorf, Hamburg, Germany). They have also been regularly tested for mycoplasma contamination by examining the samples for extracellular DNA staining with SiR-DNA (100 nM ...
-
bioRxiv - Pathology 2023Quote: ... The samples were extracted overnight at 4℃ and then centrifuged at 4,000 rpm for 5 min at 4°C using a 5810 R fixed-angle rotor centrifuge (Eppendorf, Germany). 1 ml of the upper layer of petroleum ether was dried under vacuum in a new 2-ml tube ...
-
bioRxiv - Cell Biology 2024Quote: ... All cells were kept at 37 °C and 5% CO2 in a Galaxy 170 R humidified incubator (Eppendorf, Hamburg, Germany). All cell lines have been routinely examined for mycoplasma contamination by using SPY-555-DNA (1:100 000 ...
-
bioRxiv - Microbiology 2024Quote: ... The culture was adjusted to OD600 75 by centrifuging 50 mL of culture in a conical tube at 3,220 ×g at room temperature for 5 min in a 5810 R centrifuge (Eppendorf, Germany). The supernatant was removed ...
-
bioRxiv - Neuroscience 2020Quote: ... Microinjection of 300 nl was made over 3 min using a Femtojet injector (~5 psi, Eppendorf), and the exposed cortical surface was covered by a sterilized round cover glass (3 or 4 mm in diameter ...
-
bioRxiv - Neuroscience 2020Quote: Centrifuge (Eppendorf, #5804 R)
-
bioRxiv - Microbiology 2021Quote: ... overnight cultures in LB were spun down via centrifugation for 5 minutes at 4000 rpm at room temperature (Eppendorf 5810 R). The supernatant was filtered twice (Medical Millex-GS Filter ...
-
bioRxiv - Microbiology 2024Quote: ... 50 mL culture was centrifuged for 5 min at 18 °C and 3,220 g (5810 R swing-out centrifuge; Eppendorf, Hamburg, Germany) and the supernatant was removed by vacuum suction ...
-
bioRxiv - Microbiology 2024Quote: ... The stationary pre-cultures were then pooled and washed by centrifugation (5 min, 3,220 g and 4 °C) using a 5810 R swing-out centrifuge (Eppendorf, Hamburg, Germany). After centrifugation ...
-
bioRxiv - Microbiology 2021Quote: ... 7000 RPM (5424 R, Eppendorf) for 3 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... and the cells were pelleted by centrifugation at approximately 250 × g for 5 min at 4 °C (Eppendorf 5804 R, Hamburg, Germany). After resuspension ...
-
bioRxiv - Microbiology 2024Quote: ... one with the blood mixed to RPMI and the second with the gametocyte suspension were spun down at 2000rpm for 5 minutes in a temperature-controlled centrifuge at 37°C (Eppendorf 5702 R). RPMI supernatant was removed from both tubes with 3ml disposable Pasteur pipettes ...
-
bioRxiv - Systems Biology 2024Quote: ... was recorded and 20 ml of culture were centrifuged at 1,500 x g for 5 minutes at RT (Eppendorf Centrifuge 5810 R). After centrifugation ...
-
bioRxiv - Cancer Biology 2024Quote: ... Aliquots of cells in αMEM were transferred to centrifuge tubes and centrifuged for 5 minutes at 900 rpm (Eppendorf 5804 R Benchtop Centrifuge). After removing the αMEM media ...
-
bioRxiv - Plant Biology 2023Quote: ... Bound phosphopeptides were then eluted 3 times with 100 µL ammonium hydroxide (5% v/v) into 1.5mL Lo-Bind tubes (Eppendorf). These were then frozen and lyophilized ...
-
bioRxiv - Developmental Biology 2020Quote: ... Centrifuged (720 rcf, Eppendorf 5804 R) for 5’ at 4°C to remove supernatant ...
-
bioRxiv - Plant Biology 2021Quote: ... 4 C (Eppendorf Centrifuge 5418 R). Proteins in the clear supernatant (protein extract ...
-
bioRxiv - Plant Biology 2021Quote: ... 4 C (Eppendorf Centrifuge 5418 R). 15 µg of recombinant FAMOSS-streptavidin/streptavidin was added to supernatant and incubated 1h on ice with rotation ...
-
bioRxiv - Microbiology 2022Quote: ... C (Eppendorf, 5424 R, 13523 ×g). The samples were then transferred into filter centrifuge tubes (two tubes per sample each containing (approx ...
-
bioRxiv - Biochemistry 2022Quote: ... 18213 × g (Eppendorf centrifuge 5427 R) and the supernatant was filtered using Vivaspin® 500 Centrifugal Concentrators (10,000 MWCO ...
-
bioRxiv - Synthetic Biology 2024Quote: ... A centrifuge (Eppendorf, Centrifuge 5425 R) was first pre-heated to 32 °CC ...
-
bioRxiv - Bioengineering 2024Quote: ... 4 °C (Eppendorf, Centrifuge 5810 R). Next ...
-
bioRxiv - Developmental Biology 2024Quote: ... The cells were washed with cold staining buffer (1× PBS, 0.2% BSA and 5 mM glucose) and spun down at 150 × g with low brake (Eppendorf Centrifuge 5810 R, Hamburg, Germany). The cell number was counted using a hemocytometer ...
-
bioRxiv - Cell Biology 2021Quote: ... were vortexed 3 min at room temperature followed by centrifugation at 4,500 x g for 5 min at 4°C (Eppendorf #5010R). The supernatant fluid was poured into a chilled 2 ml screw-capped tube ...
-
bioRxiv - Cancer Biology 2021Quote: ... using a refrigerated microcentrifuge 5424 R (Eppendorf). Supernatants were filtered through 0.2 µm PES membrane filters (Nalgene ...
-
bioRxiv - Genomics 2021Quote: Centrifuge 5810 R (Eppendorf, cat. no. 00267023)
-
bioRxiv - Biochemistry 2023Quote: Refrigerated microcentrifuge (Eppendorf, cat. no. 5425 R)
-
bioRxiv - Biochemistry 2021Quote: ... Cells were maintained in a humidified atmosphere of 5% CO2 and 37 °C and were passaged every 2-3 days into 10 cm polystyrene coated plates (Eppendorf; EP0030700112-300EA) upon reaching high density ...