-
No products found
because this supplier's products are not listed.
Wei-Ping Hu, et al.,
bioRxiv - Molecular Biology 2023
Quote:
Human BMPR2 ELISA Kit (orb406355, Biorbyt, United Kingdom) was used to detect the level of soluble BMPR2 in serum ...
-
No products found
because this supplier's products are not listed.
Gillian J Wilson, et al.,
bioRxiv - Immunology 2020
Quote:
... then 1 h 70% ethanol and 1 h 100% ethanol before incubation in xylene overnight (VWR international). Rehydrated was achieved by 1 h incubation in 100% ethanol ...
-
No products found
because this supplier's products are not listed.
Tom Parée, et al.,
bioRxiv - Genetics 2023
Quote:
... This mix was incubated for 30 minutes at 37°C to form ribonucleoprotein complexes and injected into hermaphrodite adult gonads using a Transjector 5246 (Eppendorf). F1 progeny were singled out from plates displaying a high proportion of the dumpy (dpy-10 ...
-
No products found
because this supplier's products are not listed.
Jun-Ping Bai, et al.,
bioRxiv - Biophysics 2024
Quote:
Control OHC complex NLC (cNLC) was measured in b6 mouse (Jackson Lab; 1-2 months old) macro-patches under voltage clamp ...
-
No products found
because this supplier's products are not listed.
Daniel Flores-Mireles, et al.,
bioRxiv - Biochemistry 2022
Quote:
... decylubiquinol:cytochrome c reductase (complex III) and cytochrome c oxidase (complex IV) by spectrophotometric measurements using a SpectraMax ABS Plus microplate reader (Molecular Devices). Unsealed mitochondrial membranes were thawed on ice and diluted to 100 μg/ml in 25 mM potassium phosphate buffer (pH 7.5 ...
-
No products found
because this supplier's products are not listed.
Nicholas S. Wilcox, et al.,
bioRxiv - Cell Biology 2021
Quote:
... After 1 h blocking with the blocking buffer (Rockland), we probed the membranes sequentially with mouse anti-HuR (clone 3A2 ...
-
No products found
because this supplier's products are not listed.
Thibault Legal, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Cheeseman, 1: 1000), guinea pig CENP-C (pAb, MBL PD030, 1:2000) and human ACA antibodies (Cambridge Biosciences, 1:100). Hoechst 33342 (ThermoFisher Scientific ...
-
No products found
because this supplier's products are not listed.
Yuting Zeng, et al.,
bioRxiv - Cell Biology 2022
Quote:
... The human EDN enzyme-linked immunosorbent assay (ELISA) kit (MBL International 7630, Woburn, MA) has a minimum detection limit of 0.62 ng/mL ...
-
No products found
because this supplier's products are not listed.
Viola Sgarminato, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Quantification of IL-6 cytokines was conducted using the IL-6 Human ELISA Kit (CRS-B001-96tests, ACROBiosystems). The concentrations were determined by referencing a standard curve ...
-
No products found
because this supplier's products are not listed.
Henri Wedekind, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Incubation with human complement factor H (Complement Technology, Texas, USA) was carried out at 37°C for 30 min in serum-free TSC medium at a final concentration of 10 µg/ml ...
-
No products found
because this supplier's products are not listed.
Hao Yan, et al.,
bioRxiv - Cell Biology 2024
Quote:
... ELISA kits were used to measure estrogen (Calbiotech ES180S-100), progesterone (IBL America ...
-
No products found
because this supplier's products are not listed.
Joshua D. Powell, et al.,
bioRxiv - Microbiology 2024
Quote:
... ELISA (IDEXX) and HI assays were performed on serum from contact pigs at 17 dpc to determine if IAV-specific antibodies were present to indicate virus transmission.
-
No products found
because this supplier's products are not listed.
Michael T.S. Girling, et al.,
bioRxiv - Animal Behavior and Cognition 2024
Quote:
The MethylFlash Global DNA Methylation (5-mC) ELISA Easy Kit (Epigentek, USA), utilising a colourimetric assay ...
-
No products found
because this supplier's products are not listed.
Madhusoodhanan Suresh Kumar Meena Kumari, et al.,
bioRxiv - Immunology 2024
Quote:
... IFN-I receptor subunit 1 (IFNAR1) blocking antibody (MAR1-5A3) and IgG isotype control antibody (MOPC-21) from BioXCell. S ...
-
No products found
because this supplier's products are not listed.
Patricia Bonnavion, et al.,
bioRxiv - Neuroscience 2023
Quote:
... incubated in blocking solution (10% donkey serum (DS) in PBST) for 1 h at room temperature and subsequently incubated for 1 h with GFP boosters (ATTO488, Chromotek) diluted 1:400 in 1% DS ...
-
No products found
because this supplier's products are not listed.
Martin P. Reichhardt, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... goat anti-factor H (Calbiochem, La Jolla, California; 1:100), mouse anti-C4bp (Quidel ...
-
No products found
because this supplier's products are not listed.
Lara Ambrosio Leal Dutra, et al.,
bioRxiv - Microbiology 2022
Quote:
... Barcoded amplicons were extracted from agarose gel (1.5%, 1 h, 100 V) by using NucleoSpin® Gel and PCR Cleanup XS kit (Macherey-Nagel) and the amplicon size and DNA concentration were checked with High Sensitivity D1000 ScreenTape assay in 2200 TapeStation System (Agilent Technologies ...
-
No products found
because this supplier's products are not listed.
Emily C. Ross, et al.,
bioRxiv - Immunology 2021
Quote:
... gondii strains (type II) [33,34] were maintained by serial 48 h passaging in human foreskin fibroblasts (HFFs; CRL-2088, American Type Culture Collection). HFFs were cultured in Dulbecco’s modified Eagle’s medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Anna Ilaria Przytula-Mally, et al.,
bioRxiv - Biophysics 2023
Quote:
... for the human CPEB3 complex and PEG/Ion screen (Hampton Research) for the chimpanzee complex ...
-
No products found
because this supplier's products are not listed.
Made Harumi Padmaswari, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Analysis of hF9 protein was performed using the Human Coagulation Factor IX Total Antigen ELISA Kit (Innovative Research) following the supplier’s protocol ...
-
No products found
because this supplier's products are not listed.
Renuka E. Joseph, et al.,
bioRxiv - Microbiology 2023
Quote:
... were sugar-starved for 24 h and then fed an infectious blood meal consisting of 1:1 anonymous human blood (BioIVT) and 107 FFU/ml of EILV-eGFP (EILV-eGFP-infected group ...
-
No products found
because this supplier's products are not listed.
Daniela Ramirez-Sanchez, et al.,
bioRxiv - Microbiology 2022
Quote:
... A ready-to-sequence SMRTBell Polymerase Complex was created using a Binding Kit 2.2 (PacBio) and the primer V5 ...
-
No products found
because this supplier's products are not listed.
Linlin You, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... β subunit overexpression was induced by adding IPTG (Gold Biotechnology) to 1 mM and cell growth was monitored until apparent OD600 reached 0.9 ...
-
No products found
because this supplier's products are not listed.
Young Eun Kim, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Heavy lysine (1G: CLM-265-H-1) and arginine (1G: CNLM-291-H-1) were purchased from Cambridge Isotope Laboratories (CIL ...
-
No products found
because this supplier's products are not listed.
Qi Ding, et al.,
bioRxiv - Neuroscience 2019
Quote:
... PI3 kinase activity was measured using PI3 kinase activity ELISA kit from Echelon Biosciences according to the manufacture’s protocol ...
-
No products found
because this supplier's products are not listed.
Adrien Birot, et al.,
bioRxiv - Genomics 2021
Quote:
... 20□mM vanadyl ribonuclease complex and 20□μM β-mercaptoethanol) with 1% 100T zymolyase (MP Biomedicals, 083209-CF) and cell wall was digested for 60min ...
-
No products found
because this supplier's products are not listed.
Sulzyk Valeria, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... to create a chamber with 30 mm depth and sperm movement was recorded by video microscopy under a light microscope (Nikon ECLIPSE E200; Basler acA-78075gc) at 400x magnification for subsequent analysis ...
-
No products found
because this supplier's products are not listed.
Maurice Michel, et al.,
bioRxiv - Biochemistry 2024
Quote:
... goat anti-human IgG-Fc Alexa488 (Dianova, 1:400) or goat antihuman IgM Alexa 594 (Molecular Probes ...
-
No products found
because this supplier's products are not listed.
Ilona Berestjuk, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Human lymphatic fibroblasts (FRC#1 and #2) were purchased from ScienCell Research Laboratories ...
-
No products found
because this supplier's products are not listed.
David J. Sherman, et al.,
bioRxiv - Cell Biology 2023
Quote:
... ribonucleoprotein complexes (PNA Bio) were generated at room temperature for 10 min ...
-
Recombinant Antigen
Cat# CMV-PENT-100,
100µg USD $367.0
Ask
Scott P. Davies, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... subunit 1 (The Native Antigen Company), followed by Alexa Fluor 555-conjugated goat anti-rabbit IgG secondary antibody (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Joseph E Kaserman, et al.,
bioRxiv - Cell Biology 2022
Quote:
Secreted total AAT was quantified from iHep supernatants using the human alpha-1-antitrypsin ELISA quantification kit (GenWay Biotech) per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Lars Borgards, et al.,
bioRxiv - Immunology 2023
Quote:
... The assay was performed according to the manufacturer’s instructions with a single technical replicate per sample (Uromodulin Human ELISA, BioVendor R&D, Cat. No.: RD191163200R; Azurocidin ELISA Kit, antibodies-online.com ...
-
No products found
because this supplier's products are not listed.
Ka Lin Heck-Swain, et al.,
bioRxiv - Immunology 2022
Quote:
... as described (38) using cTnI ELISA Kit (Life Diagnostic, #CTNI-1-HS).
-
No products found
because this supplier's products are not listed.
Lun Zhang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... in samples from brain lysates of mice and cell culture supernatants were determined using corresponding ELISA kits (pro-inflammatory cytokine ELISA kits were obtained from Neobioscience technology, anti-inflammatory cytokine ELISA kits were obtained from Bioss) according to the manufacturer’s protocols ...
-
No products found
because this supplier's products are not listed.
Xiaopeng Tang, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... FXa-AT-III complex was detected by incubation with HRP-conjugated anti-human AT-III antibody (1: 200, SAAT-APHRP, Enzyme Research Laboratory, USA). Relative level of TAT and FXa-AT-III complex was calculated.
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... Monkey IFN-gamma ELISA Kit (U-CyTech biosciences), and Monkey IL-17 ELISA Kit (U-CyTech biosciences) ...
-
No products found
because this supplier's products are not listed.
Kouhei Yoshida, et al.,
bioRxiv - Bioengineering 2023
Quote:
The AAV Titration ELISA Kit series (PROGEN Biotechnik GmbH) was used to quantify AAV capsid titers depending on the AAV serotype ...
-
No products found
because this supplier's products are not listed.
Zihao Wang, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... pH 7.0 (The Protein Complex Suite F1, Molecular Dimensions, protein: precipitant ratio 2:1). The crystal was harvested and flash-cooled without adding cryo-protectant ...
-
No products found
because this supplier's products are not listed.
Mariano I. Gabitto, et al.,
bioRxiv - Genomics 2023
Quote:
... The complex was then visualized with the intelliPATH® Ferangi Blue reaction kit (IPK5027, Biocare Medical) (blue precipitate) ...
-
No products found
because this supplier's products are not listed.
Arun Dhillon, et al.,
bioRxiv - Biochemistry 2023
Quote:
... The fractions containing the complex were concentrated to 1 mg/mL using a Vivaspin centrifugal concentrator (Sartorius).
-
A component of the Papain Dissociation System, for use in the tissue dissociation method of...
Cat# LK003178,
5 vi, $98.00
Ask
Yulong Wei, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... for 1 h followed by 300U/mL collagenase type I (Worthington Biochemical) for 2 h ...
-
No products found
because this supplier's products are not listed.
Ali Akbar Karkhaneh Yousefi, et al.,
bioRxiv - Biophysics 2023
Quote:
... using 10% Human Fn (Human Fn, Promocell) in PBS ...
-
No products found
because this supplier's products are not listed.
Janna N. Hauser, et al.,
bioRxiv - Microbiology 2022
Quote:
... The reaction was measured continuously for 1 h in a CLARIOStar plate reader (BMG Labtech) at OD420 and OD550 ...
-
No products found
because this supplier's products are not listed.
Lianghui Zhang, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and levels of the IgG1 Fc moiety were measured by Human IgG ELISA Kit (Immunology Consultants Laboratory). To characterize different routes side-by-side ...
-
No products found
because this supplier's products are not listed.
Miriana Battista, et al.,
bioRxiv - Microbiology 2023
Quote:
... The level of interleukin (IL)-6 and tumor necrosis factor (TNF)-α was also quantified by Human IL-6 and TNF-α ELISA Kits (ImmunoTools), respectively.
-
No products found
because this supplier's products are not listed.
D. C. Indurthi, A. Auerbach,
bioRxiv - Biophysics 2021
Quote:
... δ and ε subunits in the ratio 2:1:1:1 (TransIT® 293 transfection reagent; Mirus Bio, Madison, WI). Electrophysiological experiments started ~48 hours post-transfection ...
-
No products found
because this supplier's products are not listed.
Jan Fischer, et al.,
bioRxiv - Developmental Biology 2020
Quote:
Human SC102A-1 (System Bioscience) and chimpanzee Sandra A iPSC lines (Camp et al. ...
-
No products found
because this supplier's products are not listed.
Wim P. Burmeister, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The complex was eluted in five 1 mL fractions using buffer C with added 5 mM desthiobiotin (IBA Lifesciences). After addition of TCEP to 1 mM ...
-
No products found
because this supplier's products are not listed.
Arthur P. Arnold, et al.,
bioRxiv - Genetics 2023
Quote:
... XYΔ mutant rats [SD-Del(Yp)1Mcwi (RGD:155663364)] were generated at MCW by pronuclear injection of these two CRISPR-Cas9 ribonucleoproteins targeting the sequences GCATGTGGGCAGTTTCCACCTGG and ACACAGCTCCTCTCTGGTAGAGG (protospacer adjacent motif underlined) into single-cell Crl:SD (Charles River Laboratories, Crl:SD strain code 400) embryos ...