Labshake search
Citations for Charles River Labs :
1 - 50 of 421 citations for Human H ACA Ribonucleoprotein Complex Subunit 1 GAR1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... XYΔ mutant rats [SD-Del(Yp)1Mcwi (RGD:155663364)] were generated at MCW by pronuclear injection of these two CRISPR-Cas9 ribonucleoproteins targeting the sequences GCATGTGGGCAGTTTCCACCTGG and ACACAGCTCCTCTCTGGTAGAGG (protospacer adjacent motif underlined) into single-cell Crl:SD (Charles River Laboratories, Crl:SD strain code 400) embryos ...
-
bioRxiv - Cell Biology 2024Quote: HEK293 cells with constitutive expression of CaV subunits β3 and α2δ1 and inducible expression of α1D (Charles River Laboratories CT6232) were cultured in DMEM/F12 medium containing selection antibiotics and 0.6 µM isradipine (Sigma I6658) ...
-
bioRxiv - Immunology 2020Quote: ... BALB/c (H-2Kd) and BDF1 (H-2Kb/d) mice were purchased from Charles River Laboratories (Wilmington ...
-
bioRxiv - Immunology 2020Quote: Eight to 12 week-old female C57BL/6 (B6, H-2b, CD45.2) and BALB/c (H-2d, CD45.2) recipient mice were purchased from Charles River Laboratories ...
-
bioRxiv - Immunology 2020Quote: ... Balb/c (H-2b) (Charles River laboratories, USA) and male Sdc-1 knockout mice on a C57Bl/6 background (22 ...
-
bioRxiv - Immunology 2023Quote: Wild-type six- to eight-week-old female C57BL/6 J mice (H-2b) and C57BL/6 N albino mice named B6N-Tyrc-Brd/BrdCrCrl (H-2b) were purchased from Charles River Laboratories (L’Arbresle ...
-
bioRxiv - Molecular Biology 2019Quote: BALB/c (H-2d) mice were purchased from Charles River Laboratories (Wilmington ...
-
bioRxiv - Neuroscience 2022Quote: Male Sprague Dawley rats (n = 5, 16 h fasted; Charles River Laboratories Japan Inc. ...
-
bioRxiv - Bioengineering 2021Quote: Human embryonic kidney cells 293 stably expressing human hyperpolarization-gated cyclic nucleotide-sensitive cation channel 1 (HEK-HCN1) were obtained from Charles River (CT6114). Cells were cultured and maintained according to the online protocol by Charles River ...
-
bioRxiv - Immunology 2019Quote: 5-6 week old female C57BL/6 (H-2b) mice were purchased from Charles River Laboratories (Wilmington ...
-
bioRxiv - Immunology 2020Quote: Female BALB/cAnNCr (H-2d, #555) mice were purchased from Charles River (Wilmington, MA, USA). Age-matched female B10.D2 (H-2d ...
-
bioRxiv - Immunology 2019Quote: Adult female BALB/c (H-2d) Specific Pathogen Free (SPF) mice were purchased from Charles River Laboratories UK and maintained in autoclaved Individually Ventilated Cages (IVC ...
-
bioRxiv - Immunology 2020Quote: Six- to eight-week-old female C57BL/6 (H-2b) mice were purchased from Charles River Laboratory (Charles River Laboratories ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human brain metastatic cells were injected in Foxn1 Nu/Nu (Charles River, Germany) or NOD-scid IL2rγnull (NSG ...
-
bioRxiv - Neuroscience 2023Quote: ... and CHO cells stable expression of human NaV1.8 (CHO1.8) were obtained from Charles River, Neuronal NG108-15 (NG105 ...
-
bioRxiv - Immunology 2021Quote: Human CD4 knock-in (hCD4KI, genOway, Lyon, France) and wildtype C57BL/6J mice (Charles River) were injected intravenously with 5 µg (∼15 MBq ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Experiments and procedures on non-human primates were performed as fee-for-service by Charles River Laboratories with approval of Charles River’s Institutional Animal Care and Use Committee (IACUC) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Routine human and mouse pathogen screening was performed on original and passaged tissue by Charles River Laboratories (Wilmington ...
-
bioRxiv - Immunology 2022Quote: Non-human primate (NHP) studies were conducted at Charles River Laboratories (Shrewsbury, MA) and approved by Charles River-MA Institutional Animal Care and Use Committee (IACUC ...
-
bioRxiv - Cell Biology 2023Quote: CD4+ and CD8+ cells were positively selected from a de-identified healthy human donor apheresis (Charles River Laboratories) using anti-CD4 and anti-CD8 microbeads (Miltenyi ...
-
bioRxiv - Physiology 2022Quote: ... Mice expressing the cre recombinase under the control of the human cytomegalovirus minimal promoter (CMV-cre+/-) were purchased from Charles River Laboratories (Sulzfeld ...
-
bioRxiv - Developmental Biology 2022Quote: ... was used to identify potential binding partners for multimerised human CACHD1 ectodomain (prepared as above) and was performed by Charles River Discovery Research Services UK Limited (formerly Retrogenix Limited ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The effects of PF-07304814 and PF-00835231 on human red blood cell hemolysis and plasma flocculation were evaluated in GLP-compliant studies conducted by Charles River Laboratories on behalf of Pfizer Inc ...
-
bioRxiv - Immunology 2023Quote: ... Nephrectomies were performed on 12 human C5aR knock-in male mice aged 7-10 weeks by a surgeon contracted from Charles River Laboratories ...
-
bioRxiv - Microbiology 2022Quote: ... Endochrome-K kit (Charles River) was used ...
-
bioRxiv - Genomics 2021Quote: ... Pregnant mare serum gonadotropin (5 units) and human chorionic gonadotropin (5 units) were intraperitoneally injected into female C57BL/6J mice (Charles River Laboratories) with a 48-h interval ...
-
bioRxiv - Cell Biology 2023Quote: Tumors were generated by intradermal injection of 5000 human metastatic melanoma cells (1205Lu) in anaesthetized Crl:NU(NCr)-Foxn1nu (athymic nude mice; Charles River, Rockville MD). Cells stably expressing GFP-cGas and mScarlet NLS were injected in a 1:1 mixture of Matrigel and minimal essential medium (Gibco ...
-
bioRxiv - Pathology 2022Quote: ... The pregnant mare serum gonadotropin (5 units) and the human chorionic gonadotropin (5 units) were intraperitoneally injected into female C57BL/6J mice (Charles River Laboratories, Kanagawa, Japan) with a 48h interval ...
-
bioRxiv - Developmental Biology 2021Quote: Pregnant mare serum gonadotropin (five units) and human chorionic gonadotropin (five units) were intraperitoneally injected into female C57BL/6J mice (Charles River Laboratories, Kanagawa, Japan) at a 48-h interval ...
-
bioRxiv - Developmental Biology 2019Quote: ... CD-1 (Charles River) was used to generate knockout mice ...
-
bioRxiv - Developmental Biology 2019Quote: ... CD-1 (Charles River) and Coq10a-/- mouse lines were maintained according to the University of California ...
-
bioRxiv - Cell Biology 2019Quote: CD-1 (Charles River) or C57BL/6 (JAX #000664) ...
-
bioRxiv - Developmental Biology 2019Quote: ... CD-1 (Charles River), Myh6-Cre (20) ...
-
bioRxiv - Pathology 2023Quote: CD-1 (CD-1; strain #022) outbred mice were purchased from Charles River Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... male mice were paired with 1 to 2 CD-1 female mice (Charles River) each night beginning at day 5 post infection ...
-
bioRxiv - Developmental Biology 2021Quote: CD-1 mice (Charles River) were used for wild-type expression and ex vivo organ culture studies ...
-
bioRxiv - Neuroscience 2019Quote: ... CD-1 mice (Charles River). Briefly ...
-
bioRxiv - Physiology 2021Quote: ... CD-1 (Charles River Labs), and NIH-Swiss (Envigo ...
-
bioRxiv - Neuroscience 2022Quote: CD-1 mice (Charles River) were used to produce WT mouse cortical neuron cultures as shown previously (Sathler et al. ...
-
bioRxiv - Biochemistry 2021Quote: CF-1 MEFs (Charles River) were transduced with inducible S TEMCCA and rtTA lentivirus-containing supernatants overnight in 8 μg/ml polybrene (Sigma) ...
-
bioRxiv - Neuroscience 2023Quote: ... CD-1 (Charles River Laboratories), or human transferrin receptor KI ...
-
bioRxiv - Neuroscience 2023Quote: ... and CD-1 (Charles River Laboratories ...
-
bioRxiv - Neuroscience 2023Quote: ... CD-1 (Charles River Laboratories), or Sarm1-deficient mice (B6 ...
-
bioRxiv - Neuroscience 2023Quote: ... Adult CD-1 male mice and pregnant CD-1 dams were obtained from Charles River Laboratories ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Strain CRL:CD-1(ICR) ;CD-1) male and female breeder mice were obtained from Charles River Laboratories (Raleigh ...
-
bioRxiv - Immunology 2023Quote: ... 1-cell stage mouse embryos and then implanted into surrogate CD-1 mice (Charles River Laboratories). Pups born were screened for presence of the targeted allele and analyzed for proper expression ...
-
bioRxiv - Immunology 2019Quote: ... Female CD-1 mice (Charles River) were used as foster mothers ...
-
bioRxiv - Developmental Biology 2021Quote: CD-1 (Charles River stock #022) and C57BL/6J (Jackson Laboratory stock #000664 ...
-
bioRxiv - Neuroscience 2022Quote: Pregnant mice (CD-1, Charles River) were placed in a sterile environment following (dal Maschio et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... female CD-1 mice (Charles River), with an average weight of 30.2 g and age range of 6−10 weeks old ...