-
No products found
because this supplier's products are not listed.
JM Robinson, et al.,
bioRxiv - Immunology 2019
Quote:
... and LBP (Human Lipopolysaccharide Binding Protein ELISA Kit, Cell Sciences, Inc., Cat# CKH113).
-
No products found
because this supplier's products are not listed.
Kishio Furuya, et al.,
bioRxiv - Physiology 2021
Quote:
... sphingosine-1-phosphate (Huzzah S1P, Human Serum Albumin/sphingosine-1-phosphate Complex; Avanti Polar Lipids, Inc., Alabaster, AL, USA) and other active reagents were added to the perfusion medium.
-
No products found
because this supplier's products are not listed.
Jia-Pu Liang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Dex ELISA kit (Cat. No. 101516; Neogen) and E2 High sensitivity ELISA kit (Cat ...
-
No products found
because this supplier's products are not listed.
Lisa Pomeranz, et al.,
bioRxiv - Bioengineering 2023
Quote:
ELISA plates were coated with 1µg/mL human spleen ferritin (Lee Biosolutions, MO) in PBS overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Harry Klein, et al.,
bioRxiv - Plant Biology 2021
Quote:
... anti-GT1 (1:75) and anti-YSPTSPS repeat S2Pho (RNA Pol II, B1 subunit; 1:200, Diagenode). The samples were washed for 8h at 4°C with gentle agitation with PBS (0.2% v/v Tween-20 ...
-
No products found
because this supplier's products are not listed.
Verónica Rivas, et al.,
bioRxiv - Molecular Biology 2024
Quote:
Recombinant PI3K-p85 regulatory subunit was obtained from Jena Bioscience GmbH (Jena ...
-
No products found
because this supplier's products are not listed.
Philomina Sona Peramangalam, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The pA-Tn5 adapter complex containing 2.5 µl of 20x CUTANA™ pAG-Tn5 pre-loaded adapter complex (EpiCypher, #15-1017) was prepared in 50 µl of Dig-300 Buffer (20 mM HEPES pH 7.5 ...
-
No products found
because this supplier's products are not listed.
Vanessa M. Doulames, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Neurofilament-H (NFH, 1:1000 dilution; Aves Labs Inc.), Stathmin (11157-1-AP ...
-
No products found
because this supplier's products are not listed.
Suhong Sun, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... post-fixed for 1 h with 1% osmium tetroxide (Cat#18451, Ted Pella), and subject to a second fixation for 30 min with thiocarbohydrazide (Cat#88535 ...
-
No products found
because this supplier's products are not listed.
Jan Clement Santiago, et al.,
bioRxiv - Microbiology 2020
Quote:
... 1 ng human genomic DNA (Bioline, Cat. # BIO-35025) was used as negative control ...
-
No products found
because this supplier's products are not listed.
Gururaj Shivange, et al.,
bioRxiv - Biochemistry 2021
Quote:
... For coating 96-well ELISA plates (Olympus), the protein solutions (2μg/ml ...
-
No products found
because this supplier's products are not listed.
Margot Meyers, et al.,
bioRxiv - Biochemistry 2023
Quote:
DDB1 complex with CRBN (0.6 μL, 14 μM, Boston Biochem. Inc., E3-500-025) was diluted in TBS (24.4 μL ...
-
No products found
because this supplier's products are not listed.
Theodora U. J. Bruun, et al.,
bioRxiv - Biochemistry 2022
Quote:
... were coated with antigen at 1 μg/mL in 50 mM bicarbonate pH 8.75 for 1 h at room temperature then blocked overnight at 4 °C with ChonBlock Blocking/Dilution ELISA buffer (Chondrex). In the case of biotinylated antigens ...
-
No products found
because this supplier's products are not listed.
Josefa Cruz, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... ELISA was performed according to the manufacturer’s instructions using a commercial ELISA kit (Bertin Bioreagents) that detects ecdysone and 20- hydroxyecdysone with the same affinity ...
-
No products found
because this supplier's products are not listed.
Skylar J. Ferrara, et al.,
bioRxiv - Immunology 2021
Quote:
... Quantification of TREM2 concentration via ELISA was performed using a TREM2 ELISA kit (Reddot Biotech Inc). following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Zhiqiang Hou, et al.,
bioRxiv - Biophysics 2021
Quote:
2mg/ml of Mi alone and in complex with 1:1 molar ratio of heparin (AMSbio) were filtered through a 0.22 μm PES filter before 100 μL each was applied to a Superdex 200 Increase 10/300 column equilibrated in 1xPBS with 1mM TCEP ...
-
No products found
because this supplier's products are not listed.
Karen Voelkel-Meiman, et al.,
bioRxiv - Genetics 2023
Quote:
... guinea pig anti-Gmc2_Ecm11 (raised against a co-purified protein complex; ProSci Inc., 1:800), Rabbit anti-HA (Abcam ...
-
No products found
because this supplier's products are not listed.
RE Akhigbe, A.F Ajayi,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
ELISA kits used for the analysis of reproductive hormones were from Monobind Inc. ...
-
No products found
because this supplier's products are not listed.
Anne F. Cayron, et al.,
bioRxiv - Pathology 2024
Quote:
... right OA-ACA bifurcation and aortic arches of all rats were imaged using a Stemi 508 stereo microscope (Carl Zeiss). Right kidneys were weighed ...
-
No products found
because this supplier's products are not listed.
Nicole E Schmid, et al.,
bioRxiv - Microbiology 2023
Quote:
... 8 h and 24 h post-infection by following the protocol of the E.Z.N.A Bacterial DNA Kit (Omega Bio-Tek) up to the column step and then performing phenol-chloroform DNA extraction (see above ...
-
No products found
because this supplier's products are not listed.
Joseph Hiatt, et al.,
bioRxiv - Genetics 2020
Quote:
... 1% Human AB Serum (Valley Biomedical HP1022HI), Penicillin-Streptomycin (100IU and 100µg/mL ...
-
Cat# HY-P70272-10 μg,
10 μg, USD $170.0
Ask
Huan Wang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Teriparatide (Human parathyroid hormone-(1-34)) (MedChemExpress), Glu (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Amy J. Gleichman, et al.,
bioRxiv - Neuroscience 2023
Quote:
... V5 (1:400, human, Absolute Antibodies #AB00136-10.0); Myc (1:400 ...
-
No products found
because this supplier's products are not listed.
Erin M. Harberts, et al.,
bioRxiv - Immunology 2021
Quote:
... to Immulon ELISA plates (ImmunoChemistry Technologies) that were pre-coated with anti-IL-1β capture antibody (eBioscience) ...
-
No products found
because this supplier's products are not listed.
Marija Zivaljic, et al.,
bioRxiv - Neuroscience 2022
Quote:
... rabbit anti-human TMPRSS2 (Atlas antibodies HPA035787, 1:1,000), rabbit anti-human actin (Sigma A2066 ...
-
No products found
because this supplier's products are not listed.
Pedro J. Llanos, et al.,
bioRxiv - Cell Biology 2021
Quote:
... cells were washed twice and supplemented either with no cytokines or with human (h) IL-2 (200 ng/ml) and mouse (m) mIL-12 (10 ng/ml) from Shenandoah Biotechnology alone or in combination every three days.
-
No products found
because this supplier's products are not listed.
Lin Miao, Miaoxin Li,
bioRxiv - Evolutionary Biology 2021
Quote:
We curated GWAS results of 38 independent complex traits and diseases (Abbott et al. ...
-
No products found
because this supplier's products are not listed.
Leslie E. Lupien, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... human DiI-VLDLs (1 mg protein/mL; Alfa Aesar Chemicals), LPL from bovine milk (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
To help researchers in the global fight against the coronavirus, abm has developed an RT-qPCR...
Cat# G628,
100 Rxns/kit, please contact supplier for pricing.
Ask
Saurabh Bhaskar Shaw, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The complex memory task consisted of randomly interleaved blocks of autobiographical memory (ABM) retrieval trials and working memory (WM ...
-
No products found
because this supplier's products are not listed.
Xiaowei Gai, et al.,
bioRxiv - Immunology 2020
Quote:
... and collected at 24 h) using the RNAsimple Total RNA Kit (Tiangen Biotech, Beijing, China) as described in the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Yonghui Ding, et al.,
bioRxiv - Bioengineering 2023
Quote:
... were expanded in human SMC growth medium kit (Cell Applications, Inc., 311K-500) under the standard culture condition (37 °C with 5% CO2 in a humid environment ...
-
No products found
because this supplier's products are not listed.
Kellie A. Heom, et al.,
bioRxiv - Genomics 2023
Quote:
... 1 μL of Hybridase Thermostable RNase H at 45°C (Lucigen (now Biosearch Technologies), Cat ...
-
No products found
because this supplier's products are not listed.
Tamas L Nagy, Jack Strickland, Orion D Weiner,
bioRxiv - Cell Biology 2023
Quote:
... Neutrophils were isolated using the EasySep Direct Human Neutrophil Isolation Kit (STEM-CELL Tech #19666) with the BigEasy magnet (STEMCELL Tech #18001 ...
-
No products found
because this supplier's products are not listed.
Jin Luo, et al.,
bioRxiv - Microbiology 2021
Quote:
... Rezex RFQ-Fast Acid H+ (8%) (Phenomenex) was used as the column and placed at 80 °C ...
-
No products found
because this supplier's products are not listed.
Dongning Chen, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The pH of the collagen solution was adjusted to 7.4 and incubated on ice for 1 h before pipetting into a microwell plate with a glass-bottomed cutout (14 mm Microwell, MatTek, Ashland, MA). The plate was sealed with parafilm and kept in an incubator (5% CO2/balance air ...
-
No products found
because this supplier's products are not listed.
Khushali Patel, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... ELISAs were performed using a β-hCG ELISA kit (EIA-1911; DRG International Springfield NJ) and IL-1β ELISA kit (DY401-05 ...
-
Gliadin ELISA Kit
Cat# EGLD-100,
1.0 kit, 96 tests, USD $519.0
Ask
Yongxing Wang, et al.,
bioRxiv - Immunology 2023
Quote:
... Complex V activity was measured using a Quantichrom ATPase assay kit (Bioassay Systems).
-
No products found
because this supplier's products are not listed.
Estrela Neto, et al.,
bioRxiv - Cell Biology 2020
Quote:
... a multi-neurotrophin rapid screening ELISA kit (#BEK-2231, Tebu-bio, France) was used according to the manufacturers’ protocol ...
-
No products found
because this supplier's products are not listed.
Neil Chandra Dalvie, et al.,
bioRxiv - Bioengineering 2020
Quote:
Strains for initial characterization were grown in 3 mL culture in 24-well deep well plates (25°C, 600 rpm) using complex medium (BMGY-Buffered Glycerol Complex Medium, Teknova) supplemented to 4% (v/v ...
-
No products found
because this supplier's products are not listed.
Joseph W. Nors, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Oocytes were injected with 27-54 ng of total mRNA for α, β and γ subunits in a 1:1:10 ratio (Boileau et al., 2002) (Nanoject, Drummond Scientific). Oocytes were incubated in ND96 (in mM ...
-
No products found
because this supplier's products are not listed.
Halil Ibrahim Guler, et al.,
bioRxiv - Molecular Biology 2021
Quote:
ELISA KIT of COVID-19 spike protein:ACE-2 assay kit (Cat. No. 79954) was purchased from BPS Bioscience (79954), San Diego ...
-
No products found
because this supplier's products are not listed.
Masaki Okumura, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Insulin complex images were recorded with a K3 camera (Gatan) as movie micrographs at the total electron exposure on the specimen was around 80e-Å−2 and the nominal magnification at 60,000 ...
-
No products found
because this supplier's products are not listed.
Cheyenne Hurst, et al.,
bioRxiv - Neuroscience 2022
Quote:
... recombinant human Aβ42 (5 μM) (rPeptide, # A-1170-1) was handled essentially as described (67 ...
-
No products found
because this supplier's products are not listed.
Jack Polmear, et al.,
bioRxiv - Immunology 2023
Quote:
96-well high-binding ELISA plates (Sarstedt) were coated overnight at 4°C with either goat anti-mouse IgA ...
-
No products found
because this supplier's products are not listed.
Xiaoshan Shi, et al.,
bioRxiv - Biochemistry 2020
Quote:
100 nM purified ULK1 complex was mixed with 5 µM ULKtide (SignalChem Biotech Inc.), and incubated at room temperature for 1 h ...
-
No products found
because this supplier's products are not listed.
Ranganath Maringanti, et al.,
bioRxiv - Cell Biology 2023
Quote:
Cell-tracker deep red labelled THP-1 monocytes were perfused through the EC-VSMC co-cultured channels for 24 h in a cocktail medium (SMGM2: EGM2: RPMI-1:1:1) via the Ibidi pump system (Ibidi, Germany), at 5×105 cells/mL circulating medium.
-
No products found
because this supplier's products are not listed.
Yi-Pin Lin, et al.,
bioRxiv - Microbiology 2020
Quote:
... the ELISA kits to determine the levels of IFNγ and TNFα from house mouse (Mus muscuslus) (Tonbo Bioscience, San Diego, CA) were utilized to detect those cytokines in white-footed mice ...
-
No products found
because this supplier's products are not listed.
Alice Abreu Torres, et al.,
bioRxiv - Microbiology 2021
Quote:
... supplemented with 10% heat-treated (56 °C, 1 h) foetal bovine serum (FBS, Pan Biotech), 100 U/mL penicillin and 100 μg/mL streptomycin (P/S ...
-
No products found
because this supplier's products are not listed.
Antonella Conforti, et al.,
bioRxiv - Immunology 2021
Quote:
BALB/c (H-2d) and C57Bl/6 mice (H-2b) were purchased from Envigo (Italy). B6.Cg-Tg(K18-ACE2)2Prlmn/J mice were purchased from The Jackson Laboratory ...