-
No products found
because this supplier's products are not listed.
Prasun Chakraborty, Kevin Hiom,
bioRxiv - Cancer Biology 2019
Quote:
... 5-Bromo-2’-deoxyuridine (Sigma, B5002), RNase A 19101 (17,500 U ...
-
No products found
because this supplier's products are not listed.
Hiroyuki Yamamoto, Tetsuro Matano,
bioRxiv - Immunology 2023
Quote:
... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Invitrogen) and 2-mercaptoethanol (Gibco) ...
-
No products found
because this supplier's products are not listed.
Danasadat Alemalhoda, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... 20 μl of 10X 5-Bromo-2’-deoxyuridine (BrdU) (Roche, Germany) per well was added ...
-
No products found
because this supplier's products are not listed.
Jakub Netolicky, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 7-Chloro-4-hydroxy-3-(3-phenoxy)phenyl-2(1H)-quinolinone (L-701-324; Tocris); (R)-3-(2-Carboxypiperazin-4-yl)propyl-1-phosphonic acid ((R)-CPP ...
-
No products found
because this supplier's products are not listed.
Stéphane Koundrioukoff, et al.,
bioRxiv - Genetics 2023
Quote:
Cells were grown with BrdU 50 μM (5-bromo-2’-deoxyuridine, B5002, MERCK) for 30 min to label neo-synthesised DNA ...
-
No products found
because this supplier's products are not listed.
Wenyu Zhang, et al.,
bioRxiv - Microbiology 2023
Quote:
... anti-IL-8/IL-8 (MAB208, R&D Systems, 1:100), anti-CD45 (2403794 ...
-
No products found
because this supplier's products are not listed.
Marielle Breau, et al.,
bioRxiv - Molecular Biology 2021
Quote:
A subgroup of mice received an intraperitoneal injection of 5-bromo-2’-deoxyuridine (ab142567, abcam) diluted in PBS at 25mg/ml ...
-
No products found
because this supplier's products are not listed.
Anastasia Selyutina, et al.,
bioRxiv - Microbiology 2020
Quote:
... supplemented with 5 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (Corning, Corning, NY, USA), 50 μg/ml penicillin/streptomycin (Corning) ...
-
No products found
because this supplier's products are not listed.
Ya Guan, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 2-Hydroxyethyl methacrylate (HEMA, Alfa Aesar) was used before passing through a column filled with inhibitor removers ...
-
No products found
because this supplier's products are not listed.
Nicole B. Webster, Néva P. Meyer,
bioRxiv - Developmental Biology 2023
Quote:
... and 1:400 rabbit anti-phosphorylated-SMAD1/5/8 (pSMAD1/5/8; clone 41D10, Cell Signaling Technologies). Secondary antibodies used were as follows ...
-
No products found
because this supplier's products are not listed.
Bradley R Corr, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 5′-bromo-2′-deoxyuridine (BrdU) (Cat. #550891; BD Biosciences; RRID:AB_2868906) was then added directly to the well culture media (final concentration 10 µM) ...
-
No products found
because this supplier's products are not listed.
Ying Tang, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Polyclonal total SMAD 1/5/9(8) (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, #sc-6031-R) and a polyclonal actin antibody (Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Alister Burt, et al.,
bioRxiv - Cell Biology 2019
Quote:
... R 2/1 or R 3.5/1 on 300 mesh Cu/Rh grids (QUANTIFOIL) were glow discharged for 45 s at 25 mA ...
-
No products found
because this supplier's products are not listed.
Meghan Robinson, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 0.5 mM RA and 1 mM 8-bromo-cAMP (Peprotech, 2354843) were added ...
-
No products found
because this supplier's products are not listed.
Rajkumar Sadasivam, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 2-Hydroxyethyl methacrylate (99.99%, TCI), Ethylene glycol (SRL) ...
-
No products found
because this supplier's products are not listed.
Michael Chabot, et al.,
bioRxiv - Biochemistry 2020
Quote:
... HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (VWR, Radnor, PA), NaCl (VWR) ...
-
No products found
because this supplier's products are not listed.
Yetkin Çaka Ince, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Membranes were blocked with 5% milk overnight at 4°C or 1h at room temperature for Anti-GFP JL-8 (1:4000; Clontech, California ...
-
No products found
because this supplier's products are not listed.
Gabriel A. Yette, Scott Stewart, Kryn Stankunas,
bioRxiv - Developmental Biology 2021
Quote:
... and 175 μg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Promega). Reactions were stopped with three PBS rinses ...
-
No products found
because this supplier's products are not listed.
Tom Driedonks, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... After 1h of blocking in 5% Blotting-Grade Blocker (Bio-Rad) in PBS + 0.05% Tween-20 (PBS-T) ...
-
No products found
because this supplier's products are not listed.
Serapion Pyrpassopoulos, et al.,
bioRxiv - Biophysics 2019
Quote:
... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (HEPES) and Dithiothreitol (DTT) were purchased from GoldBio (St Louis, MO, US). Ethylene Glycol-bis(β-aminoethyl ether)-N,N,N′,N′-Tetraacetic Acid (EGTA) ...
-
No products found
because this supplier's products are not listed.
Christl Gaubitz, et al.,
bioRxiv - Biochemistry 2020
Quote:
Quantifoil R 2/2 (first dataset) and quantifoil R 0.6/1 (second dataset, Electron Microscopy Sciences) grids were washed with ethyl acetate and glow discharged using a Pelco easiGlow (Pelco ...
-
No products found
because this supplier's products are not listed.
Alexia Pavlidaki, et al.,
bioRxiv - Neuroscience 2022
Quote:
... incubated 1h in PTXN (NGS 5% in PTX, Vector Laboratories), incubated overnight at 4°C in primary antibodies ...
-
No products found
because this supplier's products are not listed.
Pau Perez Escriva, Tobias Fuhrer, Uwe Sauer,
bioRxiv - Microbiology 2021
Quote:
... Online mass calibration was performed using a second spray needle and a constant flow (5 ul/min) of reference solution containing purine and hexakis (1H, 1H, 3H -tetrafluoropropoxy)phosphazine (HP-0921, Agilent Technologies). Compounds were identified based on the retention time of chemical standards and their accurate mass (tolerance 20 ppm) ...
-
No products found
because this supplier's products are not listed.
Sean R. Cuddy, et al.,
bioRxiv - Microbiology 2020
Quote:
... ZD 7288 and 8-bromo-cyclic AMP (Cayman Chemicals); Nerve Growth Factor 2.5S (Alomone Labs) ...
-
No products found
because this supplier's products are not listed.
Emma E. Kovak, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... one 2 microgram portion received 5 units of RNase R (Lucigen, Middleton, WI) and the other an equal volume of nuclease-free water (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Iromi Wanigasuriya, et al.,
bioRxiv - Genomics 2020
Quote:
... 8 μL of 5 M NaCL and 1 μL of RNase A (NEB) were added to every 200 μL of eluate and to the WCE samples (diluted to 200 μL with Elution buffer) ...
-
No products found
because this supplier's products are not listed.
Florence E. McLean, et al.,
bioRxiv - Microbiology 2024
Quote:
... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) 25 mM (Lonza, 17-737F), gentamicin 25 μg/ml (Lonza ...
-
No products found
because this supplier's products are not listed.
William D Jackson, et al.,
bioRxiv - Immunology 2023
Quote:
C57BL/6 mice were treated twice with topical R848 and then were injected once I.P with 2 mg of (5-bromo-2’-deoxyuridine) BrdU (Biolegend). Bone-marrow (BM ...
-
No products found
because this supplier's products are not listed.
Nicholas Sim, Li Yinghui,
bioRxiv - Cancer Biology 2023
Quote:
... AAACTCGGAGTTCTCAGAGCCCAGC NFKB2 guide #1 F: CACCGTGGCCCCTACCTGGTGATCG NFKB2 guide #1 R: AAACCGATCACCAGGTAGGGGCCAC NFKB2 guide #2 F: CACCGCTTTCGGCCCTTCTCACTGG NFKB2 guide #2 R: AAACCCAGTGAGAAGGGCCGAAAGC pLKO.TRC (Addgene; Cat#10878) was used for generating shNMNAT1 KD in U-87 MG and U-251 MG cell lines ...
-
No products found
because this supplier's products are not listed.
Katalin Skrapits, et al.,
bioRxiv - Cell Biology 2021
Quote:
... biotin-conjugated secondary antibodies (Jackson ImmunoResearch; 1:500; 1h), ABC Elite reagent (1:1,000 ...
-
No products found
because this supplier's products are not listed.
Kazuhiro Hayashi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 25mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES)(Research Products International) or acidic pH 6.5 media (26mM NaHCO3 ...
-
No products found
because this supplier's products are not listed.
Olivier Da Ines, et al.,
bioRxiv - Genetics 2022
Quote:
... 2 mM X-Gluc (5-bromo-4-chloro-3-indolyl-ß-D-glucuronic acid; Biosynth), dissolved in N,N-dimethylformamide) ...
-
No products found
because this supplier's products are not listed.
Anthony J. Snyder, Andrew T. Abad, Pranav Danthi,
bioRxiv - Microbiology 2021
Quote:
... The purified PCR products were then processed and sequenced using the NextSeq 75 – High Output (82 cycles in read 1, 8 cycles in index 1, and 8 cycles in index 2 SE reads) (Illumina). The sequencing data was analyzed using the Model-Based Analysis of Genome-wide CRISPR/Cas9 Knockout (MAGeCK ...
-
No products found
because this supplier's products are not listed.
Gopika SenthilKumar, et al.,
bioRxiv - Physiology 2023
Quote:
... Cells were used at passage 2-5 and plated onto 8 well chamber slides (Ibidi, Gräfelfing, Germany) at 70-80% confluency.
-
No products found
because this supplier's products are not listed.
Abigail M. Schwarz, et al.,
bioRxiv - Neuroscience 2023
Quote:
Male and female CD-1 (a.k.a. ICR) mice aged 5-8 weeks from Charles River Laboratories were used for all experiments ...
-
No products found
because this supplier's products are not listed.
Andrew S Blaeser, et al.,
bioRxiv - Neuroscience 2023
Quote:
... All experiments were conducted on adult (8-16 weeks old) C57BL/6J mice (5 males, 2 females, Jackson Laboratory). Mice were group housed with standard mouse chow and water provided ad libitum before viral injection (see below) ...
-
No products found
because this supplier's products are not listed.
Mireia Seuma, et al.,
bioRxiv - Genomics 2020
Quote:
... for 1h at 37C and purified from a 2% agarose gel (QIAquick Gel Extraction Kit, Qiagen). In parallel ...
-
No products found
because this supplier's products are not listed.
Icaro Putinhon Caruso, et al.,
bioRxiv - Biophysics 2021
Quote:
... Samples of 20 μΜ N-NTD or N-NTD-SR consisting of varied protein:nucleic acid molar ratios (8:1, 4:1, 2:1, 1:1, 1:2) were prepared in low-binding microtubes (Eppendorf® LoBind) in the presence of 10% PEG-4000 (w/v ...
-
No products found
because this supplier's products are not listed.
Ayşe N. Erdoğan, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... 8-oxo-2’-deoxyguanosine-5’-triphosphate (8-oxo-dGTP) and 2’-deoxy-P-nucleoside-5’-triphosphate (dPTP) (TriLink). For each library ...
-
No products found
because this supplier's products are not listed.
François Halloy, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 5-(Benzylthio)-1H-tetrazole (Carbosynth) was used at 0.24 M concentration in dry acetonitrile to activate the phosphoramidites for coupling ...
-
No products found
because this supplier's products are not listed.
Rouhollah Habibey, et al.,
bioRxiv - Bioengineering 2023
Quote:
... SU- 8 5 and SU-8 50 (MicroChem) were subsequently spin-coated on the wafer at different heights (5 µm for microchannels and 100 µm for microwells ...
-
No products found
because this supplier's products are not listed.
Yesica R Frontini-Lopez, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5 mM MgCl2 reaction buffer containing 0.015% w/v 5-bromo-4-chloro-3-indolyl phosphate-BCIP-(Calbiochem) substrate and 0.03% w/v nitro blue tetrazolium-NBT-(BDH Chemicals Ltd. ...
-
No products found
because this supplier's products are not listed.
Súil Collins, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... The devices were silanized by pipetting a fresh solution of 2% Trichloro(1H,1H,2H,2H-perfluorooctyl)silane in HFE-7500 (3M) into the chips ...
-
No products found
because this supplier's products are not listed.
Alexander J. Knights, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and an anti-R-spondin 2 antibody (ProteinTech) or Rabbit IgG Isotype Control (Abcam ...
-
No products found
because this supplier's products are not listed.
Shailaja Seetharaman, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Dried samples were then rotary-shadowed with 2 nm of platinum and 5-8 nm of carbon using an ACE600 high vacuum metal coater (Leica Microsystems). Platinum replicas were floated off the glass by 5% hydrofluoric acid ...
-
No products found
because this supplier's products are not listed.
Panos Theofilas, et al.,
bioRxiv - Neuroscience 2021
Quote:
... for 1h at room temperature (GE Healthcare, NA934V, donkey anti-rabbit, 1:1000) a 5 min incubation with chemiluminescent HRP substrate (Thermo Fisher Scientific) ...
-
Cat# HY-N1637-1 mg,
1 mg, USD $200.0
Ask
Aleksandra Tempes, et al.,
bioRxiv - Cell Biology 2023
Quote:
... cells were treated for 2 h with 60 µM 1-adamantyl(5- bromo-2-methoxybenzyl)amine (ABMA; Medchemexpress, catalog no. HY-124801) or 50 µM chloroquine (dissolved in water ...
-
No products found
because this supplier's products are not listed.
Daisuke Tone, et al.,
bioRxiv - Neuroscience 2021
Quote:
... or 3.3 mM (Figure 5-figure supplement 1 and 8) ATP and 5 µM ProfilerPro Kinase Peptide Substrate 11 5-FAM-KKLNRTLSVA-COOH (PerkinElmer, U.S.A.), in the presence or absence of 0.66 µM CaM (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Michela Lo Conte, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and plated (200,000 cells/well) on low attachment 12-well plates coated with poly-2-hydroxyethyl methacrylate in mTeSR1 Plus (STEMCELL Technologies, Vancouver, Canada) medium with 10 μM Y27632 (Selleckchem ...
-
No products found
because this supplier's products are not listed.
Malcolm J. W. Sim, et al.,
bioRxiv - Immunology 2019
Quote:
... Receptor (R; Beckman Coulter, Z199, GL183, CD158e1/2) and KIR2DS4 (S4 ...