Labshake search
Citations for Addgene :
1 - 50 of 2558 citations for 8 Benzyloxy 5 R 2 bromo 1 hydroxyethyl 1H quinolinone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... AAACTCGGAGTTCTCAGAGCCCAGC NFKB2 guide #1 F: CACCGTGGCCCCTACCTGGTGATCG NFKB2 guide #1 R: AAACCGATCACCAGGTAGGGGCCAC NFKB2 guide #2 F: CACCGCTTTCGGCCCTTCTCACTGG NFKB2 guide #2 R: AAACCCAGTGAGAAGGGCCGAAAGC pLKO.TRC (Addgene; Cat#10878) was used for generating shNMNAT1 KD in U-87 MG and U-251 MG cell lines ...
-
bioRxiv - Biophysics 2021Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Biophysics 2022Quote: ... the pCDFDuet-1 plasmid containing His6 SARS-CoV-2 nsp7/8 (Addgene #159092) was transformed into E ...
-
bioRxiv - Cell Biology 2020Quote: ... A glass capillary with a fine tip containing plasmid solution is inserted into the eye primordium of stage 26-30 embryos to inject 8−5-8 nl doses of 1 µg/µl of pEGFPC1-hVAP-A (Addgene #104447) or pEGFPC1-hVAP-A KD/MD (Addgene #104449 ...
-
bioRxiv - Bioengineering 2024Quote: ... and exon 2-8 was cloned from Addgene #182141 ...
-
bioRxiv - Neuroscience 2021Quote: ... were added to each well along with 1 μl of Syn1-EBFP-Cre (serotype, 2-1; titer, 6×1012 genomes/mL; MOI, ∼8-0.08; Addgene, 51507-AAV1) delivered at full strength or diluted 1:103-104 ...
-
bioRxiv - Neuroscience 2023Quote: We used AAV1-hSyn-GCaMP6f (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:8 to 1:15 in saline) for experiments involving two-photon calcium imaging of V1 layer 2/3 cells ...
-
bioRxiv - Microbiology 2021Quote: ... 8 × 105 293 T cells in a 6 cm dish were cotransfected with 2 μg of HIV-1 packaging plasmid pCMVΔ8.2 R (Addgene # 12263); 0.5 μg of the pCMV-VSV-G plasmid (Addgene # 8454 ...
-
bioRxiv - Cell Biology 2023Quote: ... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
bioRxiv - Biochemistry 2021Quote: ... two double-stranded oligonucleotides targeting exon 2 of human SGTA (guide #1: 5′-CATGACCAGCTCCGGCACGG-3′ and guide #2: 5′- CAGGAACTGGATGATGGCGT-3′) were ligated into the pSpCas9(BB)-2A-puro vector (Addgene #62988) using BbsI sites ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5’-AAACCCTTATTCGTACGTGGCT-3’) foxl2l#1 and foxl2l#2 fragments were cloned into pT7-gRNA (Addgene) through one-step digestion and ligation respectively ...
-
bioRxiv - Cancer Biology 2019Quote: ... GDI2 (crGDI2-1 Fw 5’ GCCACCCGAGTCAATGGGGA 3’ and crGDI2-2 Fw 5’ CACTCTCTCCTCCGTACGTA 3’) into a lentiviral CAS9 expressing plasmid (Addgene Plasmid # 49535) using the BSMB1 restriction sites ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sgRNA pairs were manually selected from the output list and cloned into the pGECKO backbone (CRISPRi.1: 5’ GTTACTTCCAACGTACCATG 3’, CRISPRi.2: 5’ CCTGTACCCCCATGGTACGT 3’) (Addgene 78534; (68))
-
bioRxiv - Genomics 2022Quote: ... 1-10 µg YAC/BAC payload DNA and 2-5 µg pCAG-iCre plasmid (Addgene #89573) per transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... slices were virally infected with 0.5-1 µl AAV mixture per slice (containing AAV9-Camk2a-Cre at 2 × 1012 vg/ml (1:1000 dilution, Addgene and rAAV8-DIO-CBA-pAAIP2-mEGP at 4.2 x 1012 vg/ml ...
-
bioRxiv - Pathology 2019Quote: ... the full length genomic copy with promoter of MoDNM1 was amplified with MoDnm1-F (5’-AATT GAATTC GTTGAGCAGGCCGAGCGAC-3’) and MoDnm1-R (5’-AATT GAATTC CACTGGCATTTGATTACGCAAGG-3’) inserted into pFGL822 (Addgene, 558226) and introduced into the Modnm1Δ strain.
-
bioRxiv - Developmental Biology 2021Quote: ... and 8×105 cells were electroporated with 2 μg Cas9-sgRNA plasmid (Addgene: #48139), 1 µg pEGFP-Puro and 200μM (6.6 μg ...
-
bioRxiv - Systems Biology 2019Quote: ... we performed inverse PCR using F primer (5’-TGAGCGGCCGCTAGGTACCTTTAA-3’) and R primer (5’-GGCACCGGGCTTGCGGGTCATGCA-3’) and pKLV-U6gRNA-EF(BbsI)-PGKpuro2ABFP (Addgene, Plasmid #62348) as a template ...
-
bioRxiv - Developmental Biology 2021Quote: ... The fragment has been amplified using the primers F-5’-TGCAGGATCCCATCGATTCGGCCACCATGAAACGGACAG -3’ and R-5’-TAGAGGCTCGAGAGGCCTTGTCAGACTTTCCTCTTCTTCTTGG -3’) from the pCAG-CBE4max-SpG-P2A-EGFP plasmid (Addgene plasmid #139998)14 and from the pCAG-CBE4max-SpRY-P2A-EGFP plasmid (Addgene plasmid #139999)14.
-
bioRxiv - Neuroscience 2021Quote: ... AAV 2/5 hSyn-GCaMP6f was purchased from Addgene (Cat # 100837-AAV ...
-
bioRxiv - Cell Biology 2023Quote: ... Wild type Keratin 8 was cloned into pGEX-6p-1 (Addgene) (WT-K8-GST ...
-
bioRxiv - Biophysics 2023Quote: ... a pCDFDuet-1 plasmid containing His6-PPX-nsp7/8 (Addgene: 159092) was transformed into E ...
-
bioRxiv - Molecular Biology 2019Quote: ... mNT-sgRNA-R: 5’-AAACCGCGGAGCCGAATACCTCGC-3’) were cloned into the lenti-sgRNA(MS2)-zeomycin backbone (Addgene #61427) using BsmBI ...
-
bioRxiv - Molecular Biology 2022Quote: ... Virus was generated by plating 3.5×104 COS1 cells per well in a 6 well plate and transfecting them on the 2nd day with 1 ug total plasmid per well at a 5:3:2 ratio of lentiCRISPR:psPAX2(Addgene #12260):pMD2.G(Addgene#12259 ...
-
bioRxiv - Pathology 2023Quote: ... pAAV2/8 (Addgene 112864 deposited by Dr Wilson ...
-
bioRxiv - Cancer Biology 2022Quote: ... the shRNA sequences (5′-CTCATTTAGCAGACATCGCAA-3′ (shRNA-1) and 5′-CTTTACTAGGAGACGCCAATA-3′ (shRNA-2) (Zhang et al, 2012b)) were inserted into EZ-Tet-pLKO-Puro vector (Addgene, 85966), respectively ...
-
bioRxiv - Neuroscience 2021Quote: ... Pups were injected bilaterally with 2 μl of AAV9-hsyn-ACh3.0 (1.8×10^13 gc/ml) and 2 μl of AAV9-hsyn-NES-jRCaMP1b (2.5×10^13 gc/ml, Addgene) per hemisphere ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV2/8 (Addgene #112864), pAAV2/9 (Addgene #112865) ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/8 (Addgene #112864), pAAV2/9 (Addgene #112865) ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV2/8 (Addgene #112864), pAAV2/9 (Addgene #112865) ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNAs against Luciferase (Luc)(5’-CCCGGCGCCATTCTATCCGC-3’) and USF2 (#2, #3 and #5 as above) were cloned into mCherry-expressing LRCherry2.1 (Addgene #108099) vector.
-
bioRxiv - Cell Biology 2020Quote: ... sgRNAs targeting RABIF (sg #2: 5’-GAGCGAGTTAGTGTCAGCCGAGG-3’ and sg #4 5’-AGCGAGTTAGTGTCAGCCGAGGG-3’) were cloned in lentiCRISPRv2 (Addgene #52961). MDA-MB-231 cells were infected with the corresponding lentiviruses and selected with 1μg/ml puromycin (Thermo Fisher Scientific).
-
bioRxiv - Genetics 2023Quote: ... TALEN-R (Addgene #35432) and pJT039 (AAVS1-9xTetO-pEF-IGKleader-Cas9site-hIgG1_FC-Myc-PDGFRb-T2A-Citrine-PolyA ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-hSyn- GrabDA1h (n = 5 Area X hemispheres; n = 2 MST hemispheres; Addgene), AAV5-CAG- Dlight1.1 (n = 1 Area X hemisphere ...
-
bioRxiv - Systems Biology 2023Quote: ... Lentiviruses were packaged according to the following protocol: Shuttle plasmid (8 μg), psPAX2 packaging vector (2 μg, a gift from Didier Trono (Addgene plasmid #12260 ...
-
bioRxiv - Cancer Biology 2021Quote: ... two separate NR2F1 guide RNAs (guide 2: 5’-GATCCGCAGGACGACGTGGC-3’ and guide 4: 5’-GGCTGCCGTAGCGCGACGTG-3’) were cloned into pLentiCRISPRv2 (Addgene #52961). A non-targeting (NT ...
-
bioRxiv - Molecular Biology 2023Quote: ... After an incubation of 1h at room temperature with a pA-Tn5 adapter complex (Addgene #124601), the Tn5 enzyme tagmentation reaction was performed by adding a buffer containing MgCl2 to the samples and incubating for 1h at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.8 uL of a 1:1 mixture of EGFP (AAV9- Hsyn-DIO-EGFP;4.6*10^13 GC/mL; Addgene) and AAV8-GAD1-cre was injected unilaterally into VP ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:2 dilution) or AAV5-pCAG-FLEX-EGFP-WPRE (1.1 x 1013 gc/ml, Addgene; 1:2 dilution) was injected in VTA (from bregma ...
-
bioRxiv - Biochemistry 2021Quote: ... 8 μg psPAX2 (#12260, Addgene) using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Cell Biology 2023Quote: ... 10μg pAAV2/8 (Addgene #112864) and 20μg pAdDeltaF6 (Addgene #112867 ...
-
bioRxiv - Microbiology 2023Quote: ... and pBTK401 (Type 8) (Addgene_65109 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 μg pCAS9-mCherry-Frame+1 (Addgene #66940), and 5 μg of pCRISPR-HOT_mNEON plasmid (a kind gift from Hans Clevers ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 P.1 (Addgene, #170450), SARS-CoV-1 (Addgene ...
-
bioRxiv - Cancer Biology 2019Quote: ... Pfeiffer CRISPRi cells (2×108) were transduced with the top 5 half library of hCRISPRi_v2 (Addgene #83969, i.e. 5 sgRNAs per gene) at an MOI of 0.3 in 200 mL culture medium + 8 μg/mL polybrene in 2× 225 cm2 cell culture flasks ...
-
bioRxiv - Microbiology 2024Quote: The viral 5′UTR reporter constructs were synthesized using GeneArt and cloned into pLV-SARS-CoV-2 5′UTR-Luciferase (Addgene Cat#191480)32 using NdeI and BsaBI ...
-
bioRxiv - Biophysics 2022Quote: ... a pQE-30/pcl-ts ind+ plasmid containing a His6-SUMO SARS-CoV-2 nsp12 and untagged nsp7 & 8 (Addgene #160540) was transformed into E ...
-
bioRxiv - Neuroscience 2019Quote: CAG-Mito-R-GECO: CMV-Mito-R-GECO1 (a gift from Robert Campbell; Addgene plasmid # 46021 ...
-
bioRxiv - Bioengineering 2021Quote: ... and TALEN-R (Addgene #35432) plasmid (targeting upstream and downstream the intended DNA cleavage site ...
-
bioRxiv - Cell Biology 2019Quote: ... pCMV-R-CEPIA1er (Addgene #58216) [60] ...