Labshake search
Citations for New England Biolabs :
1 - 50 of 6258 citations for 8 Benzyloxy 5 R 2 bromo 1 hydroxyethyl 1H quinolinone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... 8 μL of 5 M NaCL and 1 μL of RNase A (NEB) were added to every 200 μL of eluate and to the WCE samples (diluted to 200 μL with Elution buffer) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 8 μl 5 U/μL Klenow Fragment (NEB, M0210S) and 2 μl T4 PNK (NEB ...
-
bioRxiv - Biochemistry 2023Quote: Transcription reactions were prepared at room temperature in 20 µL transcription buffer (40 µM Tris-HCl pH 8, 5 mM DTT, 10 mM MgCl2) with 2 mM NTP’s (NEB, N0450S) and 40 U/µL RNasin™ Plus (Promega ...
-
bioRxiv - Biophysics 2023Quote: ... and 5 U Klenow in 1× NEBuffer 2 (New England BioLabs) (120 μL total volume ...
-
bioRxiv - Genetics 2023Quote: ... 2 μL 1 M CaCl2 and 5 μL micrococcal nuclease (NEB, #M0247S) were added and chromatin was fragmented into predominantly mono-nucleosomes by incubation at 37°C for 15 min ...
-
bioRxiv - Genomics 2023Quote: ... (2) +28 μl Dam at 8 U/μl (NEB M0222L); (3 ...
-
bioRxiv - Bioengineering 2022Quote: ... 1X of a restriction enzyme mix [1/2 EcoRI-HF® (NEB #R3101, 2/5 Nuclease-free water, 1/10 CutSmart Buffer 10X (NEB)] ...
-
bioRxiv - Biochemistry 2019Quote: ... and then passed over an 5-8 mL amylose column (NEB). The bound protein was washed with ten CV of Amylose Wash Buffer (50 mM Tris pH 7.5 ...
-
bioRxiv - Genetics 2020Quote: ... NdeI (NEB, Figure 2 and 5) and SacII (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... by mixing 2 ul 1:10.000 diluted library with 8 ul Quant mastermix with added primers (New England Biolabs). Due to low initial concentration of adapter ligated product we made triplicates of the library ...
-
bioRxiv - Genomics 2021Quote: The supernatant was magnetically removed and the beads were resuspended in 20 µl of L3 DNA linker ligation mixture (8 µl water, 5 µl 4X ligation buffer, 1 µl RNA ligase [New England Biolabs] ...
-
bioRxiv - Biophysics 2019Quote: ... were bound to the beads in the presence of 1 µM DNA oligonucleotide 5’-TCTCCTCCGAAGAAA-3’ (targeting DNA) and 2 µL RNase H (5 units/µL, NEB) were added to the reaction ...
-
bioRxiv - Cell Biology 2021Quote: ... and DNA fragments were amplified by PCR with NEXTFlex primers (Primer 1 - 5’-AATGATACGGCGACCACCGAGATCTACAC; Primer 2 - 5’-CAAGCAGAAGACGGCATACGAGAT) and Phusion High-Fidelity DNA Polymerase (NEB) and further purified with AMPure XP beads to eliminate unligated primers and adapters ...
-
bioRxiv - Cell Biology 2021Quote: ... Libraries were amplified by PCR using NextFlex PCR primers (Primer 1 - 5’-AATGATACGGCGACCACCGAGATCTACAC; Primer 2 - 5’-CAAGCAGAAGACGGCATACGAGAT) and Phusion High-Fidelity DNA Polymerase (NEB) before three further rounds of AMPure XP purification were performed to collect fragments 150-300 bp in size ...
-
bioRxiv - Genomics 2023Quote: ... 5 μL of Digestion-2 mix (NdeI (5 U, NEB, R0111L) and/or BglII (5 U ...
-
bioRxiv - Genetics 2019Quote: ... and 5 U/µl DNA polymerase I Klenow (8 µl; New England Biolabs), and incubated for 90 min at 37°C with rotation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... αlvus tRNAPyl (Ma-tRNAPyl)35 was prepared by annealing and extending the ssDNA oligonucleotides Ma-PylT-F and Ma-PylT-R (2 mM, Supplementary Table 1) using OneTaq 2x Master Mix (NEB). The annealing and extension used the following protocol on a thermocycler (BioRad C1000 Touch™) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 5 μl of the resulting amplicon were diluted 1:4 in 1x buffer 2 (NEB), followed by denaturation and re-annealing in a nexus GSX1 Mastercycler (Eppendorf ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 1:8 dilution Cas9 protein (New England Biolabs, cat ...
-
bioRxiv - Biophysics 2023Quote: ... 2 μM X4L4 or 8 U/μL T4 DNA ligase (New England BioLabs) and an increasing amount of PEG 8k (w/v ...
-
bioRxiv - Genetics 2021Quote: ... two complementary oligos containing the guide sequence and a BbsI recognition site (Oligo F: 5’CACCGNNNNNNNNNN….3’ and Oligo R: 5’AAACNNNNNNNNNN…..C3’) were annealed and cloned into the BbsI (NEB) digested target plasmid.
-
bioRxiv - Microbiology 2023Quote: ... Plasmids were propagated in Escherichia coli NEB Turbo ((F’ proA+B+ lacIq ΔlacZM15/fhuA2 Δ(lac-proAB) glnV galK16 galE15 R(zgb-210::Tn10) TetS endA1 thi-1 Δ(hsdS-mcrB)5)) (New England Biolabs) at 37°C in lysogeny broth (LB ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µL 10X NEB Buffer #2 (NEB #B7002S), 5 µL RppH (NEB #M0356S) ...
-
bioRxiv - Microbiology 2023Quote: ... or deglycosylated by an 1h treatment with PNGase F (NEB) then eluted in 2X Laemmli as previously described.
-
bioRxiv - Molecular Biology 2020Quote: ... using 8 units of T4 RNA ligase 1 (NEB) and 8 nmol of ATP in a final volume of 8 μl for 1 h at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were split into two separate reaction tubes containing 8 μL of PCR product + 1 μL 10X NEB® Buffer #2 (New England Biolabs®). These were incubated in a thermocycler with an initial denaturation of 95 °C for 5 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... pUA_minusFP_R: 5’ggatccatcgaggtgaagacg) and circularizing the product with a bridging oligonucleotide (5’cgtcttcacctcgatggatccatgtccagacctgcaggcatg) using the NEBuilder® HiFi DNA Assembly (NEB) kit ...
-
bioRxiv - Biophysics 2021Quote: ... 5 μL proteoliposomes were mixed with 8 units of enterokinase light chain (New England Biolabs) and diluted to 20 μL ...
-
bioRxiv - Genomics 2020Quote: ... 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) for A-tailing at 37°C for 30 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μL of a mix containing 5 U of T4 RNA Ligase 2 (NEB), 1 mM ATP ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Mixes were subsequently digested 1h at 37 °C with DpnI (NEB) and used for electroporation in E ...
-
bioRxiv - Genomics 2019Quote: ... 5 μl of NEB Buffer 2 (New England Biolabs), 2 μl dNTP mix (2.5 mM) ...
-
bioRxiv - Cell Biology 2021Quote: ... resuspended in 5 ml 1x NEB Buffer 2 (NEB) and drop frozen in liquid nitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 μl Thermostable 5’App ligase (New England Biolabs), 4 μl 10 μM pre-adenylated R1R Adapter ...
-
bioRxiv - Genomics 2020Quote: ... add 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) to digest the unligated DNA fragments at 37°C for 40 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... Endo H digestion was performed at 37°C for 1h in the presence of 1X GlycoBuffer 3 and 1 µL of Endo H enzyme (NEB). The lysates were boiled and subjected to SDS-PAGE and western transfer ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 μL Bacillus stearothermophilus (Bst) DNA polymerase (8 U μl-1) (New England Biolabs), 2 μL DNA template ...
-
bioRxiv - Microbiology 2022Quote: ... 2 mM 3’-O-Me-m 7G(5’)ppp(5’)G cap structure analog (NEB S1411S), 0.5 mM GTP ...
-
bioRxiv - Cell Biology 2021Quote: ... Then 2-5 unites of RNase H (New England Biolabs) in 5 µl of 1x RNase H buffer were added to the annealed RNA-chimeric oligo mixture and the RNase H cleavage reaction was performed at 37o C for 1 h ...
-
bioRxiv - Plant Biology 2020Quote: ... 2 µl of Taq 5× Master Mix (New England Biolabs) and Milli-Q water ...
-
Cas13d-mediated isoform-specific RNA knockdown with a unified computational and experimental toolboxbioRxiv - Genomics 2023Quote: ... we performed 2 reactions per sample (20 µl 5× NEB Q5 buffer ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: GBL phosphate (8) was incubated with 5 units of calf intestinal alkaline phosphatase (CIP, New England Biolabs) in 50 mM HEPES buffer (pH 8.0 ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA pellets were resuspended in 5 µL dephosphorylation reaction mix (7 mM Tris pH 8, 1x NEB T4 PNK buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... 250 μL of 2 mg mL-1 Y289L GalT,46 50 μL of 500 kU mL-1 PNGase F (New England Biolabs, 5 U μg-1 of protein), and 62.5 μL of Lambda Protein Phosphatase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... or 8 µl RNase III (1:1000 diluted, New England Biolabs) or RNase If (1:100 diluted ...
-
bioRxiv - Bioengineering 2024Quote: ... pH 8.0) containing 8 units mL−1 proteinase K (NEB, P8107S) at 37 °C for 4 h ...
-
bioRxiv - Genetics 2024Quote: ... 1 µg of plasmid was incubated with 8 U M.SssI (NEB) at 37°C for 4 h for in vitro DNA methylation ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µl 10 x dNTPs with dUTP instead of dTTP (2 mM each) and 1 µl T4 polymerase (NEB) were added and the mixture was incubated at 37°C in a thermal cycler for 20 min ...
-
bioRxiv - Genetics 2022Quote: ... 1 µL of extracted genomic DNAs and 5 µL of 2× Hot Start High Fidelity Q5 Master Mix (NEB). PCR reactions were carried out under the following condition ...
-
bioRxiv - Biochemistry 2023Quote: ... Desalted peptides were dissolved in 1 ml 1 × CutSmart buffer (pH 8, New England BioLabs) and incubated with 50 units of alkaline phosphatase (calf intestinal ...