-
No products found
because this supplier's products are not listed.
Sascha R.A. Alles, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2,3-dihydroxy-6-nitro-7-sulfamoyl-benzo[f]quinoxaline-2,3-dione (NBQX, Tocris) and N,N,H,-Trimethyl-5-[(tricyclo[3.3.1.13,7]dec-1-ylmethyl)amino]-1-pentanaminiumbromide hydrobromide (IEM-1460 ...
-
No products found
because this supplier's products are not listed.
Alexander Bryson, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and kinate receptors was achieved with 2,3-dihydroxy-6-nitro-7-sulfamoyl-benzo[f]quinoxaline-2,3-dione (NBQX; 50 µM; Sigma, Australia), N-methyl-D-aspartate (NMDA ...
-
No products found
because this supplier's products are not listed.
Aniqa Tasnim, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and 2,3-dihydroxy-6-nitro-7-sulfamoyl-benzo[f]quinoxaline (NBQX, 5 μM; Abcam, ab120046) to block excitatory glutamatergic activity in slices ...
-
No products found
because this supplier's products are not listed.
Bhairavi Tolani, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Proton transport was measured using ATP-dependent quenching of 9-amino-6-chloro-2-methoxy-acridine (Acridine Orange, ThermoFisher) fluorescence quenching for isolated vacuoles as previously described21
-
No products found
because this supplier's products are not listed.
Elena B. Riel, et al.,
bioRxiv - Biophysics 2021
Quote:
LC-CoA (14:0, 16:0, 18:0, 18:1, 18:2, 18:3, 22:0) were purchase from Avanti Polar Lipids (Alabaster, USA) and stock solutions were prepared in DMSO (1 - 5 mM) ...
-
No products found
because this supplier's products are not listed.
Tommaso Zeppillo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 2 μM 6-cyano-7-nitroquinoxaline-2,3-dione (NBQX, Hello Bio, Bristol, UK) and 2 μM (R)-3-(2-Carboxypiperazin-4-yl)-propyl-1-phosphonic acid ((R)-CPP ...
-
No products found
because this supplier's products are not listed.
Roni F. Rayes, et al.,
bioRxiv - Cancer Biology 2021
Quote:
7-9 weeks old male C57BL/6 (Charles River, Saint Constant, QC) and TLR4-/- (from Dr ...
-
No products found
because this supplier's products are not listed.
Rebecca S. Hofford, et al.,
bioRxiv - Neuroscience 2020
Quote:
Male C57BL/6 mice (7-9 weeks old, Jackson Laboratories) were group-housed (4-5 mice/cage ...
-
No products found
because this supplier's products are not listed.
Mark Borris D. Aldonza, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Caspase 3/7 and 9 activities were assessed using a fluorescence-based Apo-ONE homogenous caspase 3/7 assay kit (Promega) and luminescence-based caspase-glo 9 assay system (Promega) ...
-
No products found
because this supplier's products are not listed.
Yutong Song, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... Luciferase activity was determined in a luminometer (Optocomp I) by the addition of ∼18 µl of sample to 6-7 µl diluted coelenterazine (for Gluc, NEB), or ∼20 µl of sample to 15-18 µl Fluc substrate (Promega).
-
No products found
because this supplier's products are not listed.
Enrica Montalban, et al.,
bioRxiv - Neuroscience 2022
Quote:
... They were recorded in the presence of 10 mM CNQX (6-cyano-7-nitroquinoxaline-2,3-dione, Merck) and 50 mM D-AP5 (D-2-amino-5-phosphonovalerate ...
-
No products found
because this supplier's products are not listed.
Maria Lozano-Rabella, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... IL-2 (Proleukin 18 IU/mL) and IL-7 (Peprotech 10 ng/mL) were added ...
-
No products found
because this supplier's products are not listed.
Kathrin S. Jutzeler, et al.,
bioRxiv - Microbiology 2024
Quote:
... We infected 5 female BALB/c and 5 female C57BL/6 mice (Envigo, 7-9 weeks old) per parasite population with 50 cercariae via tail immersion [26] ...
-
No products found
because this supplier's products are not listed.
Evelyne Krin, et al.,
bioRxiv - Microbiology 2023
Quote:
... 3-(2,4-dinitrostyryl)-(6 R,7 R)-7-(2-thienylacetamido)-ceph-3-em-4-carboxyl acid (Calbiochem), was used to assess membrane permeability ...
-
No products found
because this supplier's products are not listed.
William R. Arnold, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 18:1 Lysophosphatidic acid [(2-hydroxy-3-phosphonooxypropyl) (Z)-octadeca-9-enoate] was purchased from Cayman Chemical Company (Ann Arbor ...
-
No products found
because this supplier's products are not listed.
Yinghui Li, et al.,
bioRxiv - Genetics 2022
Quote:
... and non-inoculated G305-3M leaf segments collected along 10 different time points (0, 3, 6, 9, 12, 16, 24, 36, 48, 72 hpi) using the RNeasy Plant Mini Kit (Qiagen, Germany). The cDNA was synthesized from total RNA using a qScript™ cDNA Synthesis Kit (Quantabio ...
-
No products found
because this supplier's products are not listed.
Rupert L. Mayer, et al.,
bioRxiv - Immunology 2022
Quote:
... samples were measured by a MACSQuant 18 (Figure 5) or 16 (Supplementary Figure 6) flow cytometer and analysed by FlowJo® software (BD company). Three spleen samples from lmon_0149 vaccinated mice (Figure 5 ...
-
No products found
because this supplier's products are not listed.
Lindsay B Alcaraz, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... cytokeratin 5/6 (mouse monoclonal, clone 6D5/16 B4, Dako), epidermal growth factor receptor (EGFR ...
-
No products found
because this supplier's products are not listed.
Swagatika Paul, et al.,
bioRxiv - Cell Biology 2022
Quote:
... HeLa cells were reverse transfected with 1:3 or 1:6 X-tremeGENE 9™ (Roche) transfection reagent according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Nuno Carvalho, et al.,
bioRxiv - Pathology 2019
Quote:
... IL-9 and IL-6 determinations (Human IL-4, IL-5, IL-9 and IL-6 MAX, Biolegend, San Diego, CA 92121 USA) according to manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Delphine M Depierreux, et al.,
bioRxiv - Microbiology 2021
Quote:
... ULBP-2/5/6 (65903, R&D systems), Plexin-B1 (rea728 ...
-
No products found
because this supplier's products are not listed.
Kateryna Nechyporenko, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Either AAV-CAG-FLEXFRT-ChR2(H134R)-mCherry (n = 7, 200 nL, 3 × 1012 GC/mL, Serotype: 9; Addgene, MA, USA) to express channelrhodopsin (ChR2 ...
-
No products found
because this supplier's products are not listed.
Joanna Szuszkiewicz, et al.,
bioRxiv - Physiology 2022
Quote:
... NCS and 1 % (v/v) P/S for another 18 h on 6-well plates (collagen I-coated plates; Corning BioCoat). As for other in vitro tests ...
-
No products found
because this supplier's products are not listed.
Jonathan So, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 5 mM of IncuCyte Caspase-3/7 Green Apoptosis Assay Reagent (Sartorius, cat #4440) as well as 1:500 of Nuclight Rapid Red Dye (Sartorius ...
-
No products found
because this supplier's products are not listed.
Vanitha Nithianandam, et al.,
bioRxiv - Neuroscience 2023
Quote:
... pSMAD1/5/9 (1:2000, Cell Signaling), GABARAP (1:2000 ...
-
No products found
because this supplier's products are not listed.
Arja Ray, et al.,
bioRxiv - Immunology 2023
Quote:
... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
No products found
because this supplier's products are not listed.
Olena Zhulyn, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... with primary antibody against cytokeratin 5/6/18 (Santa Cruz Biotechnology, sc-53262) or myosin heavy chain (DSHB ...
-
No products found
because this supplier's products are not listed.
Andrea Tagliani, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Desalting columns (NAP-5 and PD-10) and N-[6-(Biotinamido)hexyl]-3’-(2’-pyridyldithio)proprionamide (HPDP-biotin) were purchased from GE Healthcare and Pierce ...
-
No products found
because this supplier's products are not listed.
Kai Dünser, et al.,
bioRxiv - Plant Biology 2021
Quote:
... 2′,7′-Bis(2-carboxyethyl)-5(6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM) from Biotium (CA, USA), Wortmannin (WM ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Gurdeep Singh, et al.,
bioRxiv - Microbiology 2019
Quote:
16S amplicon sequencing targeting the V3 and V4 variable regions of the 16S rRNA (341F: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 805R: 5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) was performed on the Illumina MiSeq platform (Illumina, California, USA) according to manufacturer’s guidelines and generated paired-end reads of 300bp in each direction ...
-
No products found
because this supplier's products are not listed.
Sungchul Shin, et al.,
bioRxiv - Bioengineering 2023
Quote:
... were expanded to passage 6 or 7 in endothelial growth media (EGM-2 BulletKit, Lonza), and culture medium was changed every other day ...
-
No products found
because this supplier's products are not listed.
Valencia L. Potter, et al.,
bioRxiv - Cell Biology 2020
Quote:
Eye cups from mice aged 4-8 months (Figures 2–5) or 10 days postnatal (Figures 6, 7, 9) were fixed for five minutes in 1% PFA (Electron Microscopy Science) diluted in 1x PBS ...
-
No products found
because this supplier's products are not listed.
Celia Barrio-Alonso, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... for 5-7 days and embedded into 2 mg/ml collagen type-I (StemCell Technologies, Vancouver, Canada) gels ...
-
No products found
because this supplier's products are not listed.
Carmen Bekeova, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 3 μm C-18 column (Phenomenex) kept at 35°C ...
-
No products found
because this supplier's products are not listed.
Alexander Belyy, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 2 mM 3’-deoxyguanosine-5’-triphosphate (3’-dGTP, Jena Bioscience) and 4 mM MgCl2 ...
-
No products found
because this supplier's products are not listed.
Emily J. Talbot, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 4 µM digitonin) with or without 7 µM 2’,3’-cGAMP (Invivogen). Cells were further washed in PBS and incubated in culture medium until collection ...
-
Purified by the method of Williams, Sung and Laskowski, J. Biol. Chem., 236, 1130 (1961). ...
Cat# LS003926,
100 un, $96.00
Ask
Nicole Amberg, et al.,
bioRxiv - Neuroscience 2022
Quote:
... DNase I (vial 3, Worthington), Ovomucoid protease inhibitor (vial 4 ...
-
No products found
because this supplier's products are not listed.
Lisa G.M. van Baarsen, et al.,
bioRxiv - Immunology 2021
Quote:
... AEC (3-Amino-9-EthylCarbazole; Vector Laboratories, Burlingame, CA) was used as chromogen ...
-
No products found
because this supplier's products are not listed.
Angela Criscuolo, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 1,2-Dipalmitate-3-linoleate-glycerol (TG 16:0/16:0/18:2) and cholesteryl linoleate (CE 18:2) were purchased from Larodan (Solna, Sweden). Oxylipin standards (15(S)-hydroperoxy eicosatetraenoic acid ...
-
No products found
because this supplier's products are not listed.
Anthoni M. Goodman, et al.,
bioRxiv - Neuroscience 2020
Quote:
... containing dorsal hippocampus (from 3, 6, 9, 12, 15, 19, and 24 month-old) were cut from PFA-fixed hemispheres (Leica vibratome VT1000P) and stored in 0.1M phosphate-buffered saline (PBS ...
-
Cat# HY-107377-10 mM * 1 mL,
10 mM * 1 mL, USD $66.0
Ask
Isadora Oliveira Prata, et al.,
bioRxiv - Microbiology 2021
Quote:
1-(2,3-di(Thiophen-2-yl)quinoxalin-6-yl)-3-(2-methoxyethyl)urea (CAS 508186-14-9 – MCE-MedChemExpress) is an Acetyl-CoA Synthetase 2-specific and potent inhibitor ...
-
No products found
because this supplier's products are not listed.
Monica N. Hernandez, Steven E. Lindow,
bioRxiv - Microbiology 2020
Quote:
... 5 μl DNase I (6 U/μl) (Zymo Research) and 75 μl DNA Digestion Buffer (Zymo Research ...
-
No products found
because this supplier's products are not listed.
Daniel T. Hass, Colin J. Barnstable,
bioRxiv - Neuroscience 2019
Quote:
... we injected 6 µm (2 µL at 3×106 beads/µL; Polysciences, Cat#: 07312-5) and 1 µm (2 µL at 1.5×107 beads/µL ...
-
No products found
because this supplier's products are not listed.
Alberta Giovanazzi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Gradients were ultracentrifuged at 192,000xg for 16 - 18 hours at 4°C (Beckman Coulter Optima XPN-80 with a SW40Ti rotor) ...
-
No products found
because this supplier's products are not listed.
Vinícius Elias de Moura Oliveira, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or a linear OXTR antagonist [125I]-d(CH2)5[Tyr(Me)2-Tyr-Nh2]9-OVT (Perkin Elmer, USA) as tracers ...
-
No products found
because this supplier's products are not listed.
Kristina Žuna, et al.,
bioRxiv - Biophysics 2023
Quote:
... and nuclease-free water (#7732-18-5) from VWR (Vienna, Austria). 14C-malic acid was purchased either from Perkin Elmer (Waltham ...
-
No products found
because this supplier's products are not listed.
Yaman Musdal, et al.,
bioRxiv - Biochemistry 2023
Quote:
The steroids 5-androsten-3,17-dione and 4-androsten-3,17-dione were purchased from Steraloids Inc ...
-
No products found
because this supplier's products are not listed.
Aidan B Estelle, et al.,
bioRxiv - Biophysics 2023
Quote:
... either labeled with 5’ 6-carboxyfluorescein or unlabeled and reverse complement 14mer (5’-GACGUCCAUGUGCC-3’) were purchased from GenScript. The dsRNA was prepared by annealing the ss-14mer (5’-GGCACAUGGACGUC-3’ ...
-
No products found
because this supplier's products are not listed.
Stephen D. Glasgow, et al.,
bioRxiv - Neuroscience 2020
Quote:
... [Ca2+]i signals were acquired using MetaFluor 7 software (Molecular Devices). All recordings were performed at rt ...