-
No products found
because this supplier's products are not listed.
Qi Qu, et al.,
bioRxiv - Physiology 2023
Quote:
... TAG(16:0)3-d5 and TAG(18:0)3-d5 (CDN isotopes), while DAGs d5-DAG17:0/17:0 and d5-DAG18:1/18:1 (Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Megan E. Huber, et al.,
bioRxiv - Immunology 2022
Quote:
... α-IL-18 (D044-3, MBL International Corporation), α-IgG2A isotype (400224 ...
-
No products found
because this supplier's products are not listed.
Ghazal Vahidi, et al.,
bioRxiv - Physiology 2023
Quote:
... followed by Rayon fine cloths and alumina pastes (9, 5, 3, 1, 0.5, 0.3, and 0.05 μm, Ted Pella, Inc.).
-
No products found
because this supplier's products are not listed.
Ligia B. Schmitd, et al.,
bioRxiv - Neuroscience 2024
Quote:
... mice were anesthetized with isoflurane (5% induction, 2-3% maintenance, SomnoSuite Kent Scientific) 10d after the first SNC and the crush placed immediately proximal to the first one ...
-
No products found
because this supplier's products are not listed.
Evan R. Buechel, Heather W. Pinkett,
bioRxiv - Biochemistry 2023
Quote:
... then equilibrated for 5 minutes at 18°C in a Spark (Tecan) plate reader prior to fluorescence polarization measurements ...
-
No products found
because this supplier's products are not listed.
Surya Prakash Rao Batta, et al.,
bioRxiv - Cell Biology 2022
Quote:
HUVECs (passage 2 to 6; PromoCell) were routinely cultured in EBM media supplemented with the provided growth factors kit (Promocell) ...
-
No products found
because this supplier's products are not listed.
Antonella Conforti, et al.,
bioRxiv - Immunology 2022
Quote:
... using either BIOLASETM polymerase (7×10-5 approximate error/bp) or MyFiTM polymerase (7×10-5 approximate error/bp) both from Bioline (Meridian Bioscience, USA). The PCR mixture consisted of 1X buffer with 1mM dNTP ...
-
No products found
because this supplier's products are not listed.
Anne-Sophie Pépin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 3 kcal/g) or high-fat diet (n=16; HFD; Research Diets Inc. ...
-
No products found
because this supplier's products are not listed.
Ya-Lin Lu, et al.,
bioRxiv - Neuroscience 2020
Quote:
AGO HITS-CLIP was performed on cells after 2 weeks into reprogramming of miR-NS or miR-9/9*-124-expressing neonatal fibroblasts (ScienCell, 2310) at day 14 and day 21 ...
-
No products found
because this supplier's products are not listed.
Alexander G. Ball, et al.,
bioRxiv - Immunology 2020
Quote:
... Stained samples were washed and resuspended in 500 μL of 1x PBS + 2% FBS (flow buffer) before 5 μg/mL of 7-AAD (AAT Bioquest) was added ...
-
No products found
because this supplier's products are not listed.
Georgia Taylor, Julia Walter, Johannes Kromdijk,
bioRxiv - Plant Biology 2023
Quote:
... after which a fully expanded leaf (rosette leaf number 7-9) was clamped into the cuvette of an open gas exchange system (LI6400XT, LI-COR) with a 2 cm2 integrated fluorometer head (Leaf Chamber Fluorometer ...
-
No products found
because this supplier's products are not listed.
Susan L. McEvoy, et al.,
bioRxiv - Genomics 2024
Quote:
... HMW gDNA was sheared to 15-18 Kb using Diagenode’s Megaruptor 3 system (Diagenode, Belgium; cat. B06010003). The sheared gDNA was concentrated using 1x of SMRTbell cleanup beads for the repair and a-tailing incubation at 37°C for 30 minutes and 65°C for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Per Niklas Hedde, et al.,
bioRxiv - Microbiology 2020
Quote:
... Four replicates of antigen patterns were printed in a 18 × 18 dot arrangement onto each 7 mm × 7 mm pad of the 2 × 8 pad nitrocellulose-coated microarrays slides (Grace Bio-Labs, Bend, OR) with an OmniGrid 100 microarray printer (GeneMachines) ...
-
No products found
because this supplier's products are not listed.
Ambre Guillory, et al.,
bioRxiv - Plant Biology 2024
Quote:
... root samples were incubated overnight in the dark at 28 °C in Z-buffer containing 2 mM Magenta-Gal (5-bromo-6-chloro-3-indoxyl-b-D-galactopyranoside; B7200; Biosynth) or X-Gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside ...
-
No products found
because this supplier's products are not listed.
Martin Wohlwend, et al.,
bioRxiv - Physiology 2024
Quote:
... Adeno-associated virus (AAV) 9 was bilaterally injected in gastrocnemius muscle at 18-month of age with 2 x 1011 viral particles (Vector Biolabs, United States) containing scramble short hairpin RNA (shRNA ...
-
No products found
because this supplier's products are not listed.
Craig Schindewolf, et al.,
bioRxiv - Microbiology 2022
Quote:
... cells were treated 16 – 20 hours prior to infection with Universal Type I IFN (PBL Assay Science #11200-2), diluted in Dulbecco’s phosphate-buffered saline ...
-
No products found
because this supplier's products are not listed.
Cherrelle Dacon, et al.,
bioRxiv - Immunology 2022
Quote:
... 7 μm streptavidin beads (Spherotech, SVP-60-5) coated in tandem with 10 μg/mL MERS-CoV spike and 10 μg/mL OC43-CoV spike were re-suspended in a cocktail of 2.5 μg/mL goat anti-human IgG-Alexa Fluor 647 (Jackson ImmunoResearch ...
-
No products found
because this supplier's products are not listed.
Yana Blokhina, Abigail Buchwalter,
bioRxiv - Molecular Biology 2023
Quote:
... and selected with 6 μg/mL blasticidin (RPI Research Products, Cat# 3513-03-9). Expression of pXLone-dCas9-DNMT3A3L-P2A-EGFP was induced with 2 μg/mL Doxycycline (VWR ...
-
No products found
because this supplier's products are not listed.
Steven R. Talbot, et al.,
bioRxiv - Animal Behavior and Cognition 2020
Quote:
... the cecum was 2/3 ligated (Nylon Monofilament Suture 6/0, Fine Science Tools GmbH, Heidelberg, Germany) distal to the ileocecal valve ...
-
No products found
because this supplier's products are not listed.
Salima Messaoudi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... dorsal-ventral (D/V): 2] using a glass micropipette (Drummond Scientific Company, Wiretrol I, 5-000-1050) was performed ...
-
No products found
because this supplier's products are not listed.
Méghane Sittewelle, Stephen J. Royle,
bioRxiv - Cell Biology 2023
Quote:
... 6 mM of 2-deoxyglucose (Apexbio) and 10 mM of sodium azide (G-Biosciences ...
-
No products found
because this supplier's products are not listed.
Amandine Velt, et al.,
bioRxiv - Genomics 2022
Quote:
... SMRT sequencing on a Sequel I machine (3 SMRTCells; PacBio) and dedicated library preparation were performed according to provider’s procedure.
-
No products found
because this supplier's products are not listed.
D.A.D. Flormann, et al.,
bioRxiv - Biophysics 2021
Quote:
... the samples were sputtered with 6-7 nm platinum (Coater: Model 681; Gatan, USA).
-
No products found
because this supplier's products are not listed.
Bianca Dietrich, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... inhibition of NOTCH signalling in P1 organoids was achieved by adding either 50 µM [(2R,4R,5S)-2-benzyl-5-(Boc-amino)-4-hydroxy-6-phenyl-hexanoyl]-Leu-Phe-NH2 trifluoroacetate salt (L-685,458; Bachem) or 10 µM Deshydroxy LY-411575 (DBZ ...
-
No products found
because this supplier's products are not listed.
Isabella A. Bagdasarian, et al.,
bioRxiv - Bioengineering 2023
Quote:
... 2 pieces of tubing (0.07” outer diameter, 18” long, Cole-Parmer, Vernon Hills, IL) and 2 18 ga ...
-
No products found
because this supplier's products are not listed.
Jenny L. M. Digby, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... MEIS1/2/3 (Active Motif 39796) and LTL (Vectorshield FL-1321) ...
-
No products found
because this supplier's products are not listed.
Sherylanne Newton, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and incubated at 37°C overnight (16-18 hr) with rabbit anti-Ribeye A domain (1:200, Synaptic Systems Cat# 192 103, RRID:AB_2086775) and mouse anti-GluR2 (1:200 ...
-
No products found
because this supplier's products are not listed.
Alyssa N Coyne, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 18 mm x 18 mm 1.5 high tolerance coverslips (MatTek). NeuN or GFP positive nuclei were imaged by super resolution structured illumination microscopy (SIM ...
-
18 Well Chambered Cover Glass with #1.5 high performance cover glass (0.170±0.005mm), with lid,...
Cat# C18-1.5H,
48/case, $219.00
Ask
Taemoon Chung, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 3×105 MIA PaCa-2/GemLuc cells were either plated day -1 on a black-walled 6 well plate (Cellvis, Mountain View, CA) or a clear bottom 6 well plate (Corning ...
-
No products found
because this supplier's products are not listed.
Roxana M. Rodríguez Stewart, et al.,
bioRxiv - Microbiology 2020
Quote:
Caspase 9 activity was measured by using Caspase-9 Colorimetric Assay Kit (Biovision). MDA-MB-231 cells were adsorbed with T1L ...
-
No products found
because this supplier's products are not listed.
Arushi Varshney, et al.,
bioRxiv - Genomics 2023
Quote:
... Samples in each batch were pulverized in four groups of 10 or 11 samples (each sample weighing between 6-9 mg) using a CP02 cryoPREP automated dry pulverizer (Covaris 500001) and resuspended in 1 mL of ice-cold PBS ...
-
No products found
because this supplier's products are not listed.
Ana M. Espino, et al.,
bioRxiv - Microbiology 2020
Quote:
... Same set of 18 samples reported as SARS-CoV-2 IgG positive were also tested by Abbott Architect SARS-CoV-2 IgG (Abbott Laboratories Diagnostics Division Abbott Park ...
-
No products found
because this supplier's products are not listed.
Sherman Qu, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... [15N]5-2-deoxyadenosine was obtained from Cambridge Isotope Laboratories ...
-
No products found
because this supplier's products are not listed.
G Rodger, et al.,
bioRxiv - Microbiology 2023
Quote:
The QuaTest BTSQ 4-in-1 (Beta/Tetra/Sulfa/Quino) rapid test kit (Ringbio, China) was validated according to the manufacturer’s instructions using serial dilutions of ampicillin (Cambridge Bioscience, UK), doxycycline (Merck Life Science ...
-
No products found
because this supplier's products are not listed.
Omar Al-Jourani, et al.,
bioRxiv - Biochemistry 2022
Quote:
... l-arabino-oligosaccharides (DP = 2-9) obtained commercially (Megazyme) were used as standards at a concentration of 25 μM ...
-
No products found
because this supplier's products are not listed.
Timur B. Kamalitdinov, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 5-days post-surgery along with 5-Ethynyl-2′-deoxyuridine (EdU, Click Chemistry Tools, 3 mg/kg) every day (n = 4-5/group) ...
-
No products found
because this supplier's products are not listed.
Sara Đaković, et al.,
bioRxiv - Microbiology 2023
Quote:
... brucei cultured at 37°C and 5% CO2 in HMI-9 media (PAN Biotech) supplemented with 10% fetal calf serum (Gibco) ...
-
LC Laboratories' Product Number D-7878 - Daidzin (4',7-Dihydroxyisoflavone...
Cat# D-7878, SKU# D-7878_300mg,
300 mg, $144.00
Ask
Yao-Chang Tsan, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Cardiac differentiations were performed using Wnt modulation.1,2 We achieved optimal differentiations using RPMI plus B27 supplement without insulin during day 0-2 (CHIR 5-6 µM during first 24 hours, LC Laboratories), then CDM3 media (without B27 ...
-
No products found
because this supplier's products are not listed.
Mykhailo Y. Batiuk, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 2 were prepared using FCS Express 7 Plus v7.04.0014 (De Novo Software).
-
No products found
because this supplier's products are not listed.
Laura Maria Florez, et al.,
bioRxiv - Immunology 2023
Quote:
... between passages 3 and 7 in complete mouse endothelial cell medium (from Cell Biologics, Euromedex) composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics ...
-
No products found
because this supplier's products are not listed.
Thorsten M. Leucker, et al.,
bioRxiv - Cell Biology 2021
Quote:
... PCSK9 mRNA expression was assessed by real-time PCR using PCSK9 primer sets 5’-TGTCTTTGCCCAGAGCATC-3’ and 5’-GTCACTCTGTATGCTGGTGTC-3 (Integrated DNA Technologies) and SYBR Select Master Mix (ThermoFisher, ABI 4472908).
-
No products found
because this supplier's products are not listed.
Naihua N. Gong, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Flies aged 5-7 days were anesthetized on CO2 pads (Genesee Scientific Cat #59-114) and loaded into individual glass tubes (with 5% sucrose and 2% agar ...
-
No products found
because this supplier's products are not listed.
Alexia Caillier, et al.,
bioRxiv - Cell Biology 2022
Quote:
... The supernatant was diluted with 9 mL cold PBS and free puromycin was removed by centrifugation using Macrosep 3 kDa centrifugal filters (Pall). Concentrated lysate was diluted in non-denaturing lysis buffer (10 mM Tris pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Stuart A. Collins, et al.,
bioRxiv - Neuroscience 2023
Quote:
... EPSPs were evoked at 0.1 Hz in layer 5 pyramidal neurons by electrical stimulation (100-200 µA) of layer 2/3 using an extracellular stimulating electrode (FHC, ME, USA). Membrane properties in mPFC pyramidal neurons were recorded before and 25 min after the 10Hz light stimulation ...
-
No products found
because this supplier's products are not listed.
Mathilde Bergamelli, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Immunostainings were performed with the following antibodies: rabbit anti-Cytokeratin-7 (Genetex; 2 μg/mL), mouse anti-Vimentin (Santa-Cruz ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Bradley M. Roberts, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Iris 9 Scientific CMOS camera (Teledyne Photometrics), 525/50 nm emission filter (Cairn Research) ...
-
No products found
because this supplier's products are not listed.
Ji Wang, et al.,
bioRxiv - Pathology 2021
Quote:
... 5-7 μL were injected and analyzed using a hybrid 6500 QTRAP triple quadrupole mass spectrometer (AB/SCIEX) coupled to a Prominence UFLC HPLC system (Shimadzu ...
-
No products found
because this supplier's products are not listed.
Dong Yan Zhang, et al.,
bioRxiv - Neuroscience 2024
Quote:
... The 16 capillary tubes (NanoTemper Technologies) were inserted into each sample tube to enable sample entry into the capillary ...
-
No products found
because this supplier's products are not listed.
Galen J. Correy, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 0.1 M MES pH 6.5 at a 1:1 ratio at 16°C were used to prepare a microseed stock with seed beads (Hampton Research). Large-volume crystals of ligand-free Mac1 were grown using a Hampton nine-well sandwich box set up with 150 μl drops of Mac1 (∼19 mg/ml ...