-
No products found
because this supplier's products are not listed.
Yasmine Iacone, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and ELA (N-[4-[2-(3,4-Dihydro-6,7-dimethoxy-2(1H)-isoquinolinyl)ethyl]phenyl]-9,10-dihydro-5-methoxy-9-oxo-4-acridinecarboxamide) were purchased from Sigma-Aldrich. For systemic injections ...
-
No products found
because this supplier's products are not listed.
Zheng-Hui Zhao, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Nuclei were stained with 4′,6-diamidino-2-phenyl-indole (DAPI, Life Technologies) and sections were examined with a confocal laser scanning microscope (Carl Zeiss Inc ...
-
No products found
because this supplier's products are not listed.
Jessica L Hoffman, et al.,
bioRxiv - Neuroscience 2022
Quote:
5-[2-Chloro-6-(trifluoromethoxy)phenyl]-1,3-dihydro-2H-benzimidazol-2-one (JNJ-5; Tocris, Minneapolis, MN) is a high affinity ...
-
No products found
because this supplier's products are not listed.
Elliot J. Medcalf, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1H,1H,2H,2H-perfluorooctanol (Alfa Aesar) was added (1:1 ratio to oil) ...
-
No products found
because this supplier's products are not listed.
Jack Stubbs, et al.,
bioRxiv - Biochemistry 2024
Quote:
... a volume of 1H,1H,2H,2H-perfluoro-1-octanol (PFO, Merck) is added to the emulsion with gentle pipetting used to break the emulsion ...
-
No products found
because this supplier's products are not listed.
Nitin Wadhwani, et al.,
bioRxiv - Cancer Biology 2022
Quote:
SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay.
-
No products found
because this supplier's products are not listed.
Annamarie E. Allen, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Cells were incubated in treatment media for the indicated period of time and then MTS reagent ((3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) purchased from Abcam, (ab197010 ...
-
No products found
because this supplier's products are not listed.
Lubna Amer, Maurice Retout, Jesse V. Jokerst,
bioRxiv - Bioengineering 2023
Quote:
The percent toxicity was calculated using an XTT (2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide) colorimetric assay (Biotium) wherein viable cells form an orange formazan product upon reduction ...
-
No products found
because this supplier's products are not listed.
Simon Lind, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and AR-C118925 {5-[[5-(2,8-dimethyl-5H-dibenzo[a,d]cyclohepten-5-yl)-3,4-dihydro-2-oxo-4-thioxo-1(2H)-pyrimidinyl]methyl]-N-2H-tetrazol-5-yl-2-furancarboxamide} were obtained from Calbiochem-Merck Millipore (Billerica ...
-
No products found
because this supplier's products are not listed.
Emily C. Britt, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 2-chloro-4,5-difluoro-N-[[[2-methoxy-5-[[(methylamino)carbonyl]amino]phenyl]amino] carbonyl]-benzamide (Cayman Chemical, no. 17578) were used ...
-
No products found
because this supplier's products are not listed.
Súil Collins, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... The devices were silanized by pipetting a fresh solution of 2% Trichloro(1H,1H,2H,2H-perfluorooctyl)silane in HFE-7500 (3M) into the chips ...
-
No products found
because this supplier's products are not listed.
Joshua D. Kerkaert, et al.,
bioRxiv - Microbiology 2021
Quote:
... and 300μL of XTT solution was added to each well (0.5mg/mL XTT [2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide] (VWR) with 25μM menadione in PBS) ...
-
No products found
because this supplier's products are not listed.
Thomas W. Jackson, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and 1H, 1H, 2H, 2H-Perfluorohexane-1-ol (4:2-FTOH, CAS 2043-47-2, purity ≥ 97%) were from TCI America (Portland ...
-
No products found
because this supplier's products are not listed.
Nicholas Dillon, et al.,
bioRxiv - Microbiology 2020
Quote:
... hexakis (1H,1H,2H-difluoroethoxy)-phosphazene (SynQuest Labs, Inc.) was used as a “lock mass” internal calibrant (m/z 622.028960 ...
-
No products found
because this supplier's products are not listed.
Carmen de Pablo, Sergio Casas-Tintó,
bioRxiv - Cancer Biology 2023
Quote:
... DNA was stained with 2-(4-amidinophenyl)-1H-indole-6-carboxami-Dine (DAPI) at 1 μM in Vectashield mounting media (Vector Laboratories).
-
No products found
because this supplier's products are not listed.
Jasmin van den Heuvel, et al.,
bioRxiv - Cell Biology 2021
Quote:
... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
No products found
because this supplier's products are not listed.
Sho C. Takatori, et al.,
bioRxiv - Biophysics 2022
Quote:
... 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-methoxy(polyethylene glycol)-3000 (PEG3k PE; catalog number: 880330) were purchased from Avanti polar lipids.
-
No products found
because this supplier's products are not listed.
Howard J. Teresinski, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Recombinant CaM was purified using phenyl-sepharose resin (Phenyl Sepharose® 6 Fast Flow, GE Healthcare Inc.) as described (Bender et al. ...
-
No products found
because this supplier's products are not listed.
Caleb Ruiz-Jiménez, et al.,
bioRxiv - Immunology 2021
Quote:
... was incubated with 50μl MTT (sodium 3′-[1-(phenylaminocarbonyl)-3,4-tetrazolium]-bis (4-methoxy-6-nitro) benzene sulfonic acid hydrate) labeling reagent (Roche Life Science, USA) to each well ...
-
No products found
because this supplier's products are not listed.
Paweł Czerniawski, et al.,
bioRxiv - Plant Biology 2022
Quote:
... camalexin and indole-3-acetonitrile (IAN) were performed using Agilent 1200 HPLC System (Agilent, USA) equipped with diode array and fluorescence (FLD ...
-
No products found
because this supplier's products are not listed.
Qian Chen, et al.,
bioRxiv - Genomics 2020
Quote:
... 2 μl 10 mM dATP and 5 μl Klenow Fragment (3’ −> 5’ exo-) (NEB) for A-tailing at 37°C for 30 min ...
-
No products found
because this supplier's products are not listed.
Rayan Khaddaj-Mallat, et al.,
bioRxiv - Neuroscience 2021
Quote:
Pericytes viability was assessed using the 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) assay according to the manufacturer’s procedure (Cell Signaling Technology). Cells were plated at the appropriate concentration in 96-well plates under different experimental conditions ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... sgRNAs against Luciferase (Luc)(5’-CCCGGCGCCATTCTATCCGC-3’) and USF2 (#2, #3 and #5 as above) were cloned into mCherry-expressing LRCherry2.1 (Addgene #108099) vector.
-
No products found
because this supplier's products are not listed.
Yihe Huang, Wei Lü, Juan Du,
bioRxiv - Biophysics 2023
Quote:
... For nanodisc samples, 0.5 mM (1H, 1H, 2H, 2H-Perfluorooctyl)-β-D- Maltopyranoside (FOM, Anatrace) was added for improving particles distribution and contrast ...
-
No products found
because this supplier's products are not listed.
Patarasuda Chaisupa, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... Deuterated indole-3-acetic acid (d7-IAA, Cambridge Isotope Laboratories) was used as an internal standard at a concentration of 75 nM in all samples and standards ...
-
No products found
because this supplier's products are not listed.
Samantha A. Scott, Jingjing Fu, Pamela V. Chang,
bioRxiv - Microbiology 2023
Quote:
... and indole-3-acrylate (IA) was purchased from Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Delphine M Depierreux, et al.,
bioRxiv - Microbiology 2021
Quote:
... ULBP-2/5/6 (65903, R&D systems), Plexin-B1 (rea728 ...
-
No products found
because this supplier's products are not listed.
Bolutife Fakoya, et al.,
bioRxiv - Microbiology 2021
Quote:
... Five female C57BL/6 dams with 2–3-day old litters (P2-3) (Charles River) were singly housed with their pups ...
-
No products found
because this supplier's products are not listed.
Kevin C. Wilkins, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 500 mM Auxin (Indole-3-acetic acid) in DMSO (Corning #25950CQC) or DMSO alone were added at a 1:1000 dilution to the media ...
-
Cat# HY-W091541-10 mg,
10 mg, USD $55.0
Ask
Julius Brandenburg, et al.,
bioRxiv - Immunology 2020
Quote:
... and 1,4-dihydro-1-[(2R)-2-(2-methoxyphenyl)-2-[(tetrahydro-2H-pyran-4-yl)oxy]ethyl]-a,a,5-trimethyl-6-(2-oxazolyl)-2,4-dioxothieno[2,3-d]pyrimidine-3(2H)-acetamide (“ACC2 inhibitor 3” known as ND-64652; MedChemExpress, Sollentuna, Sweden). DMSO served as a solvent control (0.1% in cell culture medium).
-
No products found
because this supplier's products are not listed.
Tom Driedonks, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... After 1h of blocking in 5% Blotting-Grade Blocker (Bio-Rad) in PBS + 0.05% Tween-20 (PBS-T) ...
-
No products found
because this supplier's products are not listed.
Tuce Tombaz, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Experimental mice were 3 to 7 month old wild type C56BL/6 females (6 from Taconic Bioscience, 2 from The Jackson Laboratory), individually housed on a 12 hr inverted light/dark cycle with ad libitum access to food and water ...
-
No products found
because this supplier's products are not listed.
Kehui Xiang, David P. Bartel,
bioRxiv - Molecular Biology 2021
Quote:
... indole-3-acetic acid (IAA, GoldBio) was dissolved in ethanol and added to cells at a concentration of 0.5 mM ...
-
No products found
because this supplier's products are not listed.
Lauren Kane, et al.,
bioRxiv - Genetics 2021
Quote:
Indole-3-acetic acid (auxin) (MP Biomedicals 102037) was added to the medium either 6 (SCC1-AID ...
-
No products found
because this supplier's products are not listed.
Yoshiki Matsuda, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
No products found
because this supplier's products are not listed.
Alexander Belyy, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 2 mM 3’-deoxyguanosine-5’-triphosphate (3’-dGTP, Jena Bioscience) and 4 mM MgCl2 ...
-
No products found
because this supplier's products are not listed.
Antonios Apostolopoulos, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
No products found
because this supplier's products are not listed.
Estefanía Lozano-Andrés, et al.,
bioRxiv - Biophysics 2022
Quote:
... #131-8; #130-6; #130-5; #130-3 and 2 μm lot MM2307#156; #159.1; #159.2; #122.3, BD Biosciences, San Jose, CA). For calibration of the fluorescence axis in the PE channel ...
-
No products found
because this supplier's products are not listed.
Chang-Bin Jing, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... or either of two different gRNAs targeting exon 3 coding sequences of human TET2 (TET2-gRNA #1: 5’-TGGAGAAAGACGTAACTTC-3’ and TET2-gRNA #2: 5’-TCTGCCCTGAGGTATGCGAT-3’) were transfected with Nucleofector (Lonza). After transduction ...
-
No products found
because this supplier's products are not listed.
Pinanong Na-Phatthalung, et al.,
bioRxiv - Immunology 2023
Quote:
... The nuclei were stained with 3 µM DAPI (4’,6-diamidino-2-phenylindole; BioLegend, #422801) for 5 min ...
-
No products found
because this supplier's products are not listed.
Shan Lin, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... IL-3 and IL-6 (PeproTech 300-07 ...
-
No products found
because this supplier's products are not listed.
Kyung Bae Min, et al.,
bioRxiv - Microbiology 2020
Quote:
... and Dkstatin-2 (N-ethyl-3-[(3-fluorophenyl)methoxy]-N-[(1-methyl-1H-imidazol-5-yl)methyl]aniline) were purchased from Chembridge Corp ...
-
No products found
because this supplier's products are not listed.
C. Jenul, et al.,
bioRxiv - Microbiology 2023
Quote:
... hexakis (1H,1H,2H-difluoroethoxy)phosphazene ions (Apollo Scientific, m/z 622.1978) located on a wick within the source was used ...
-
No products found
because this supplier's products are not listed.
Pojeong Park, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 4-[(2S)-2-[(5-isoquinolinylsulfonyl)methylamino]-3-oxo-3-(4-phenyl-1-piperazinyl)propyl] phenyl isoquinolinesulfonic acid ester (KN-62; Tocris and HelloBio); D-AP5 (HelloBio) ...
-
No products found
because this supplier's products are not listed.
Daniel T. Hass, Colin J. Barnstable,
bioRxiv - Neuroscience 2019
Quote:
... we injected 6 µm (2 µL at 3×106 beads/µL; Polysciences, Cat#: 07312-5) and 1 µm (2 µL at 1.5×107 beads/µL ...
-
No products found
because this supplier's products are not listed.
Min Yao, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and human IgG ELISA kit (Mabtech, #3850-1H-6).
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
No products found
because this supplier's products are not listed.
Zackary Sabetta, et al.,
bioRxiv - Neuroscience 2023
Quote:
A total of 64 young adult age-matched male and naturally cycling female Sprague-Dawley rats (~3 months old; males 367 ± 3 g and females 235 ± 1.5 g; n = 5-6/group; Envigo, Indianapolis, IN, USA) were used in these experiments and maintained in a 12:12 h light:dark cycle in a temperature and humidity-controlled room ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Charlotte Martinat, et al.,
bioRxiv - Microbiology 2020
Quote:
... filtered through 45 μm-pore size filters and concentrated onto a 20% sucrose cushion by ultracentrifugation (24,000 rpm, 2h, 6°C) using a SW32 rotor (Beckman). HIV-1-based lentiviral particles were produced by co-transfecting 293T cells with packaging (psPAX2) ...