Labshake search
Citations for Roche :
1 - 50 of 3169 citations for 6 methoxy 2 phenyl 3 2H tetrazol 5 ylmethylsulfanyl 1H indole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... was incubated with 50μl MTT (sodium 3′-[1-(phenylaminocarbonyl)-3,4-tetrazolium]-bis (4-methoxy-6-nitro) benzene sulfonic acid hydrate) labeling reagent (Roche Life Science, USA) to each well ...
-
bioRxiv - Biochemistry 2022Quote: (His)6-GST-SNX15 MIT was bound to cOmplete His-Tag purification beads (5 mL, Roche, Germany, 2h) and washed with 2 L wash buffer ...
-
bioRxiv - Cancer Biology 2021Quote: ... the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT) assay (11465007001, Roche Diagnostics, Mannheim, Germany) was performed according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and 2) 5 10^6 copies of bacteriophage MS2 RNA (Roche) were spiked in per isolation ...
-
bioRxiv - Neuroscience 2020Quote: ... and blocked for 2h at RT (2% Boehringer Blocking Reagent (Roche), 20% inactivated sheep serum in MABT) ...
-
bioRxiv - Neuroscience 2022Quote: ... and blocked for 2h at RT (2% Boehringer Blocking Reagent (Roche), 20% inactivated sheep serum in MABT) ...
-
bioRxiv - Plant Biology 2023Quote: ... before to add chemiluminescent substrate CSPD® (disodium 3-(4-methoxyspiro {1,2-dioxetane-3,2’-(5’-chloro)tricyclo [3.3.1.13,7]decan}-4-yl) phenyl phosphate) (Roche). The chemio-luminescent signal was detected by using a G-Box (Syngene).
-
bioRxiv - Microbiology 2023Quote: ... 1ml of CDP-Star® Chemiluminescent Substrate (Disodium 2-chloro-5-(4-methoxyspiro[1,2-dioxetane-3,2′-(5-chlorotricyclo[3.3.1.13.7]decan])-4-yl]-1-phenyl phosphate) (Roche, Cat No. 11685627001) was added to 9ml of DIG-detection buffer and membranes were then incubated with the substrate for 5 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’/3’RACE Kit (Roche) was used to amplify the RNA obtained and the final DNA was sequenced to obtain the +1 nucleotide of str ...
-
bioRxiv - Microbiology 2019Quote: ... and pretreatment for 2h with neuraminidase (Roche) was done as previously described (Maruyama et.al ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... ∼200-300 embryos were dechorionated 3-6 hours after injection by 5 min incubation in 1 mg/ml pronase (Roche) in E3 medium in a 2% agarose-coated petri dish and washed with excess amount of fresh E3 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reaction was set by using qPCRBIO Probe Mix Hi-ROX (Nippongenetics) and TaqMan (5’: 6-FAM, 3’: TAMRA) or UPL (Universal Probe Library, Roche) probes ...
-
bioRxiv - Developmental Biology 2022Quote: ... bleached with 6% hydrogen peroxide in PBS for 1h and treated with 10 μg/ml Proteinase K (Roche, Mannheim, Germany) for 20 min (5 min for epithelia ...
-
bioRxiv - Genomics 2021Quote: ... rp49 5’-TAATACGACTCACTATAGGGCAGTAAACGCGGTTCTGCATG-3’ and 5’-CAGCATACAGGCCCAAGATC-3’) were transcribed using the Biotin RNA Labeling Mix (Roche) and T7 polymerase (Promega).
-
bioRxiv - Genetics 2021Quote: ... 6-diamidino-2-phenylindole (Hoechst; Roche, Rotkreuz, Switzerland) for nuclei ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Embryos were then washed with wash buffer and their nuclei stained with 5 ug/mL DAPI (4′,6-diamidino-2-phenylindole, Roche) prepared in wash buffer for 10 minutes at 30 ºC.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 30 mM mgCl2 x 6 H2O and 5 mg/mL glucose-6-phosphate dehydrogenase (Roche Diagnostics) in 0.1 M potassium phosphate buffer pH 7.4 ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Developmental Biology 2021Quote: ... for five minutes at room temperature before being incubated in the dark with 2% Nitro-Blue Tetrazolium Chloride/5-Bromo-4-Chloro-3⍰-lndolyphosphate p-Toluidine Salt (NBT/BCIP; Roche) in buffer 3 at room temperature until staining developed ...
-
bioRxiv - Biophysics 2021Quote: ... 10% w/v glycerol, 20 mM imidazole, 5 mM 2-mercaptoethanol, 1 mM PMSF, 3 U/mL benzonase, 1X Roche complete protease inhibitor without EDTA) ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3 and 6 post transfection using WST-1 dye (Roche, Basel, Switzerland) as previously described 17.
-
bioRxiv - Microbiology 2022Quote: The V4 hypervariable region of the 16S rRNA gene was amplified with the primer pair 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3) on a Fast Start High Fidelity PCR System (Roche, PQ) using the following conditions ...
-
bioRxiv - Molecular Biology 2020Quote: ... and then with DAPI (4′,6-Diamidino-2-phenylindole, Roche) for 15 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... Isolated tissue was cut in pieces of 2 cm and digested for 1h at 37°C in a HBSS solution containing 1% P/S and 2 U ml-1 Dispase II (Roche). Epidermal layer was separated from the dermis using two tweezers ...
-
bioRxiv - Cancer Biology 2020Quote: ... An overnight blunt ligation was induced for the 5’ of exon 1 and the 3’ of exon 3 (5 U T4 DNA ligase (Roche, Basel, Switzerland)) at room temperature ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5-Bromo-4-chloro-3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5-Bromo-4-chloro- 3-indolyl phosphate (BCIP, [Roche]) and nitro blue tetrazolium chloride (NBT ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5-bromo-4-chloro-3-indolyl-phosphate (BCIP, Roche), and levamisole (1359302 ...
-
bioRxiv - Immunology 2022Quote: ... nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI) (Roche) for 4 min at room temperature and observed them under a Laserscaing Confocal Microscopy (TCS SP8 STED ...
-
bioRxiv - Cell Biology 2023Quote: ... or 1µg/mL 4’,6’-diamidine-2’-phenylindole dihydrochloride (DAPI) (Roche).
-
bioRxiv - Immunology 2023Quote: ... samples were counterstained with 4’,6-Diamidino-2-phenylindol (DAPI, Roche).
-
bioRxiv - Developmental Biology 2021Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate (BCIP, Roche).
-
bioRxiv - Immunology 2019Quote: ... for 3 h followed by 5 mM ATP (10519987001, Roche) or 20 μM nigericin (N-7143 ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP, Roche) in NTMT pH9.5 solution (100mM NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... 5-bromo-4-chloro-3-indolyl-phosphate (BCIP, #11383221001, Roche) and 2-(4-Iodophenyl)-3-(4-nitrophenyl)-5-phenyltetrazolium Chloride (INT ...
-
bioRxiv - Neuroscience 2021Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate (Roche Diagnostics) in detection buffer ...
-
bioRxiv - Immunology 2020Quote: ... for 3 h followed by 5 mM ATP (10519987001, Roche) for 45 min were used as positive controls for caspase-1 and IL-1β blots ...
-
bioRxiv - Neuroscience 2023Quote: ... #11383213001)/BCIP (5-bromo-4-chloro-3-indolyl phosphate, Roche, #11383221001) color development substrate via AP activity ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate solution (Roche). Images were captured using a BX-50 microscope (Olympus Corp. ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei were counterstained with 4’,6-Diamidine-2’-phenylindole-dihydrochloride (DAPI; Roche).
-
bioRxiv - Molecular Biology 2023Quote: ... nuclei were stained using 4’,6-diamidino-2-phenylindole (DAPI, Roche Diagnostics) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM 2-mercaptoethanol) with protease inhibitors (Roche) and 300 U/L benzonase (Sigma) ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM 2-Mercaptoethanol and protease inhibitor (Roche). The lysis proceeded by 3 passages in a French press cell at a pressure of 1500 psi ...
-
bioRxiv - Microbiology 2020Quote: ... G355-5 cells were transfected with 1 to 6 µg DNA in 6 cm dishes using X-treameGENE 9 (Roche, Basel, Switzerland). The 293T/17 cell line was obtained from ATCC (CRL-11268 ...
-
bioRxiv - Neuroscience 2021Quote: ... and 5’-GCTTGAGGTAGC CCTGTTGTCACC-3’ using KAPA HiFi Hotstart polymerase (Roche:KK2602). This PCR reaction produced a 185 bp wild type band and a 750 bp knockout band in heterozygous animals ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 0.035 mg/ml 5-bromo-4-chloro-3-indolyphosphatase (Roche). Images were acquired by the Leica MZ10F microscope with the DS-Ri1 camera.