Labshake search
Citations for Origene Technologies :
1 - 50 of 118 citations for 6 methoxy 2 phenyl 3 2H tetrazol 5 ylmethylsulfanyl 1H indole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: 5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
bioRxiv - Microbiology 2023Quote: AREG: 5’-GCACCTGGAAGCAGTAACATGC-3’ (Fwd) and 5’-GGCAGCTATGGCTGCTAATGCA-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: TEAD3: 5’-AGGCAGTAGATGTGCGCCAGAT-3’ (Fwd) and 5’-TCCTGGATGGTGCTGTTGAGGT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: TEAD1: 5’-CCTGGCTATCTATCCACCATGTG-3’ (Fwd) and 5’-TTCTGGTCCTCGTCTTGCCTGT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: BCL9L: 5’-CCGCTCTACCACAATGCCATCA-3’ (Fwd) and 5’-CTGAGTTCAGGTGCATCTGGCT-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: AMOTL2: 5’-AGTGAGCGACAAACAGCAGACG-3’ (Fwd) and 5’-ATCTCTGCTCCCGTGTTTGGCA-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: BCL9: 5’-TCCAGCTCGTTCTCCCAACTTG-3’ (Fwd) and 5’-GATTGGAGTGAGAAAGTGGCTGG-3’ (Rev) (sequences from Origene)
-
bioRxiv - Microbiology 2023Quote: RPLP0: 5’-TGGTCATCCAGCAGGTGTTCGA-3’ (Fwd) and 5’-ACAGACACTGGCAACATTGCGG-3’ (Rev) (sequences from Origene);
-
bioRxiv - Microbiology 2023Quote: PYGO1: 5’-GGTTAGGAGGACCAGGTGTACA-3’ (Fwd) and 5’-AGCAGCCACTAGATGGTCAGAG-3’ (Rev) (sequences from Origene)
-
bioRxiv - Neuroscience 2020Quote: ... ShRNA sequences against rat Zdhhc3 (5’-GAGACATTGAACGGAAACCAGAATACCTC-3’) and Zdhhc7 (5’-ATGACATGGCTTCTGGTCGTCTATGCAGA-3’) were purchased from Origene and subcloned ...
-
bioRxiv - Cell Biology 2019Quote: ... ShRNA sequences specific for hERG1a 5’-GCGCAGCGGCTTGCTCAACTCCACCTCGG-3’ and its control 5’-GCACTACCAGAGCTAACTCAGATAGTACT-3’ were provided by Origene into a pGFP-V-RS vector ...
-
bioRxiv - Cell Biology 2021Quote: ... the small hairpin (shRNA)-expressing vectors pSUPER.neo (R4-1) (Fleig et al., 2012) and a pRS vector-based construct targeting 5’- ATGAGGAGACAGCGGCTTCACAGATTCGA-3’ (R4-2) (OriGene) were used ...
-
bioRxiv - Cell Biology 2020Quote: ... siERCC8 (5′-GGAGAACAGAUAACUAUGCUUAAGG −3′) and siRNA duplex control (Origene) was diluted with DMEM to a final concentration of 20□nM ...
-
bioRxiv - Cancer Biology 2021Quote: ... with 3 @g of either pCMV-6-Entry vector (OriGene, cat# PS100001, Rockville, MD) or pCMV-6-Entry expressing the CKB TrueORF (cat#RC203669) ...
-
bioRxiv - Cancer Biology 2019Quote: ... shSIRT3_#4: 5’-TCACATTCTGTTGACTCTCCATACTCAGC-3’) in pRS vector (Origene, TR309432) were used to stably transfect OVCA433 cells (Supp ...
-
bioRxiv - Bioengineering 2023Quote: ... Sections were then developed using the respective Polink-2 Plus HRP with DAB kit (Origene, D87-6 Hamster D39-6 Rabbit). Sections were counterstained in Hematoxylin (EMS ...
-
bioRxiv - Microbiology 2021Quote: Full length human ACE-2-MycDDK in pCMV-6 entry vector (Origene, cat #RC208442) was expressed in Expi293™ cells ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 28 bp human sequence was 5’- CCTTCTAACTACCAGCAGTTGATATGAG -3’ (TL306482A, OriGene, Rockville, MD, USA) and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μg of pLenti-Envelop vector and 6 μg of packaging plasmids (OriGene Technologies, Inc. Rockville, MD) to isolate lentivirus according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Samples were incubated 1h at 4°C with anti-MYC magnetic beads (TA150044, Origene). Beads were washed 5 times with lysis buffer without inhibitors ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the 29 bp mouse sequence was 5’- CATCAAGTAGATGGTGTTCAGTTTATGTG -3’ (TL502431B, OriGene, Rockville, MD, USA). A shRNA 29-mer scrambled shRNA was used as a negative control (TR30021V ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were generated after transfection with pRS-puro-shWRN (5′-AGGCAGGTGTAG-GAATTGAAGGAGATCAG-3′; sequence ID: TI333414 Origene) and puromycin selection (Palermo et al. ...
-
bioRxiv - Genomics 2021Quote: ... containing a single guide RNA target sequence 5’-TAGGTCGCCAAAATCCACAC-3’ or the pCas-Guide CRISPR vector (OriGene, KN519669G2) containing a single guide RNA target sequence 5’-CGAGGCGTTTGACCCACCAG-3’ or a combination of the two was transfected into the mouse submandibular salivary gland cell line SIMS using Thermo Fisher’s Lipofectamine 3000 Reagent kit in the following manner ...
-
bioRxiv - Cell Biology 2021Quote: ... Incubation with primary antibodies at 37°C for 1h included goat β-catenin antibody (cat# AB0095) from OriGene Biotechnologies (Rockville ...
-
bioRxiv - Developmental Biology 2021Quote: ... at 56°C for 40min and re-probed with anti–GFP antibody for 1h (1:1000, Origene R1091P). Band intensity was measured using the histogram function on the Fiji software ...
-
bioRxiv - Molecular Biology 2022Quote: A 1.6-kb full length human PAX9 cDNA clone (GeneBank™, accession number NM_006194.1) containing 5’ and 3’ UTRs was purchased from OriGene Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... The different fragments were PCR amplified using custom designed primers representing the 5’ and 3’ sequence respectively with Tau cDNA (RC213312, Origene) as template ...
-
bioRxiv - Genomics 2021Quote: ... it was determined that the greatest knockout efficiency had been achieved using the pCas-Guide CRISPR vector with guide RNA sequence of 5’-TAGGTCGCCAAAATCCACAC-3’ (OriGene, KN519669G1). These cells were chosen to produce individual clones using standard single cell cloning techniques in 96-well plates.
-
bioRxiv - Cell Biology 2021Quote: ... human TCEAL4 transcript variant 1) and pCMV6-TCEAL4 isoform-2 (CAT#: SC335597, NM_001300901, human TCEAL4 transcript variant 5) were both from Origene. TCEAL4 isoform-1 was cloned from pCMV6-TCEAL4-MYC-FLAG with the Gateway cloning system into pDONR223 and then into the destination vector pEGFP_GW ...
-
bioRxiv - Cancer Biology 2022Quote: ... the 3’UTR of FOXP2 was generated from the FOXP2 3’UTR plasmid (Origene, #SC212500, NM_014491) by PCR ...
-
bioRxiv - Bioengineering 2023Quote: ... and MDR1-*3 obtained from OriGene Technologies ...
-
bioRxiv - Biochemistry 2023Quote: ... Recombinant pure human 14-3-3σ (Origene) or mutations [12] (0.5 µg) ...
-
bioRxiv - Biochemistry 2023Quote: The human spastin and mGFP-spastin constructs were cloned using the sequence corresponding to isoform 3 (UniProtKB reference sequence Q9UBP0-3; OriGene), a shortened variant derived from use of an alternative start residue (Met-87) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and (OriGene, CAT #TA-50011-3, 1:2000) with donkey anti-rabbit HRP and sheep anti-mouse HRP secondaries (1:10000).
-
bioRxiv - Bioengineering 2024Quote: ... and incubated with 5 μg/ml anti-human FcγRIIa (Origene, clone OTI9G5; 5 μg/ml) in blocking solution at 4°C overnight ...
-
Molecular basis of proteolytic cleavage regulation by the extracellular matrix receptor dystroglycanbioRxiv - Biochemistry 2024Quote: Full-length human dystroglycan cDNA in CMV-6 plasmid was obtained from Origene and used as a template for all of the cloning ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μg of PLG (Origene) were diluted in PBS together with 3 μg of D-Val-Leu-Lys 4-nitroanilide dihydrochloride chromogenic substrate (S-2251 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μg of PLG (Origene) were diluted in PBS together with 3 μg of S-2251 (Sigma ...
-
bioRxiv - Molecular Biology 2019Quote: ... cells were transfected with 3 μL of Turbofectin 8.0 (Origene) and 1,000 ng of total DNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... The full length MAFG 3’UTR sequence (NM_002359.3 OriGene, USA) was a gift from I ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transfected with 2 and 15 nM siRNA against Nrf-2 (Origene, USA, SR321100) and hTERT (Origene ...
-
bioRxiv - Molecular Biology 2019Quote: ... Plasmids were transfected into HAP1 cells seeded on a 6-well plate with Turbofectin (OriGene) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 x 106 iPSNs were nucleofected with 5 μg of antibody and 4 μg Trim21 GFP plasmid DNA (Origene) with Lonza P3 Primary Cell 4D Nucleofector Kit (Lonza ...
-
bioRxiv - Molecular Biology 2022Quote: ... and ELP3 siRNA 2 (OriGene#SR310519B)) or with pcDNA 4/T0 derivative plasmid expressing canonical ELP3 (pcDNA 4/T0-ELP3) ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293T cells were seeded at a density of 1.4x105 cells per well in 6-well plates and transfected with 0.5-2.5ug of LRRC37A plasmid (Origene) or empty vector control (Origene ...
-
bioRxiv - Cancer Biology 2021Quote: ... RAW 264.7 cells were treated with 5 ng/ml murine recombinant IL-18 protein or 5 ng/mL murine recombinant IL-20 protein (Origene, Rockville, MD, USA) for 72 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... Galectin-3-binding protein ORF was subcloned from its source vector (Origene # RC204918) into bicistronic lentiviral transfer vector pHR-CMV-TetO2 3C-TwinStrep-IRES-EmGFP vector (Addgene ...
-
bioRxiv - Biochemistry 2023Quote: ... which were prepared using 10 pmol/well (of 6 well cell culture plate) Acot2 or control siRNA (Origene) and 1.5ul of Lipofectamine RNAiMAX using forward transfection ...
-
bioRxiv - Genetics 2021Quote: ... alpha 2 (IFNA2) (OriGene Technologies Inc, Atlanta, GA) (100 ng/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... TFE3 variant 2 human ORF cDNA clone (Origene, Rockville ...