-
No products found
because this supplier's products are not listed.
Jason Yun, et al.,
bioRxiv - Bioengineering 2023
Quote:
... indole-3-acetic acid from Neta Scientific (Hainesport, NJ, USA), asunaprevir was purchased from AdooQ Biosciences (Irvine ...
-
No products found
because this supplier's products are not listed.
Rachel L. Neve, et al.,
bioRxiv - Microbiology 2021
Quote:
... 2-heptylquinolin-4(1H)-one (HHQ, Ark Pharm); 2-heptyl-4-hydroxyquinoline N-oxide (HQNO ...
-
No products found
because this supplier's products are not listed.
Darryl A. Wesener, et al.,
bioRxiv - Microbiology 2020
Quote:
... [1,2,3,4,5,6- 2H]-Myo-inositol (CDN Isotopes) was used as an internal standard ...
-
No products found
because this supplier's products are not listed.
Luca A. Altevogt, et al.,
bioRxiv - Bioengineering 2024
Quote:
... lithium phenyl-2,4,6-trimethylbenzoylphosphinate (LAP) was purchased from Ambeed; hydrogen peroxide (27-30% ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
G Maddaloni, YJ Chang, RA Senft, SM Dymecki,
bioRxiv - Neuroscience 2023
Quote:
... 3 steps (2 steps for Fluorogold [Fluorochrome] injections) of 5 nL each (1 min apart ...
-
No products found
because this supplier's products are not listed.
Benjamin Orris, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 2-14C labeled 2’-deoxythymidine-5’-triphosphate (2-14C-dTTP) was obtained from Moravek biochemicals ...
-
No products found
because this supplier's products are not listed.
Elana M. Meijer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 3 x 3 dotted patterns were created on the membranes of a 6-well Bioflex culture plate (untreated, Flexcell Int). Videos were captured at day 3 (the first day of straining ...
-
No products found
because this supplier's products are not listed.
Shuai Qi, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... 5 ul 2×Taq PCR mix (TIANGEN, China), 0.5 ul each primer (trnL and trnF (Taberlet et al. ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Jana Schuettpelz, et al.,
bioRxiv - Cell Biology 2024
Quote:
... cells were incubated with 100 nM CCCP for 1h or Ink128 (MLN0128, AdooQ) for 24 h.
-
No products found
because this supplier's products are not listed.
Michal H. Kolář, et al.,
bioRxiv - Biophysics 2021
Quote:
The VemP constructs (VemP-1, VemP-2, and VemP-3) were synthesized by Biomatik using solid state synthesis at a 95% purity level ...
-
No products found
because this supplier's products are not listed.
Lars Emil Larsen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... using a 5 µL Hamilton Neuros Syringe (33 gauge, point style 3, Hamilton company, USA) and a Quintessential Stereotaxic Injection System (Stoelting ...
-
No products found
because this supplier's products are not listed.
Eric Largy, Valérie Gabelica,
bioRxiv - Biophysics 2020
Quote:
... an MX Series II 2 Position/6 Port UltraLife Switching Valve (IDEX Health & Science, Oak Harbor, WA, USA) was used (see Figure S3) ...
-
No products found
because this supplier's products are not listed.
Holly C. Ford, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Cells were harvested 2-3 hours later and lysed using a cell disrupter (Constant Systems Ltd.). Proteins were purified from inclusion bodies using Nickel affinity chromatography on prepacked HisTrap FF columns (Cytiva ...
-
No products found
because this supplier's products are not listed.
Sen Yang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... all culture medium was replaced by 2-3 ml of Hibernate E low fluorescence buffer (BrainBits) supplemented with 2mM GlutaMAX™ to maintain the ambient pH environment.
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Robert G. Mealer, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The reactions were quenched with 2 μL 5% hydroxylamine solution (Oakwood Chemical, Cat # 069272), and the combined mixture was lyophilized ...
-
No products found
because this supplier's products are not listed.
Benjamin P. Brown, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... L747_A750>P (#E10-12MG, lot G1200-3), and L747_E749 (#E10-12LG, lot G1344-5) were purchased from SignalChem. The Promega ADP-Glo™ kinase assay kit was used to quantify the amount of ADP produced by each EGFR variant in 1XBFA buffer and in the presence or absence of erlotinib at varying concentrations ...
-
No products found
because this supplier's products are not listed.
Anne Berthold, Vett Lloyd,
bioRxiv - Molecular Biology 2022
Quote:
... starting material for the exposure experiments were HUVECs in passage 3 and HEK-293 cells in passage 5 seeded at a density of 4000 cells/cm2 into 6-well tissue culture plates (Celltreat, 229105) in antibiotic-containing media ...
-
No products found
because this supplier's products are not listed.
M. Kyle Cromer, et al.,
bioRxiv - Genetics 2021
Quote:
... The sgRNA modifications added were the 2’-O-methyl-3’-phosphorothioate at the three terminal nucleotides of the 5’ and 3’ ends described previously38. All Cas9 protein (SpyFi S.p. Cas9 nuclease) was purchased from Aldevron, LLC (Fargo ...
-
No products found
because this supplier's products are not listed.
Kendall Carrasco, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 5 nL of compounds were dispensed (2 x 2.5 nL fixed dispensing using an Echo550 (Labcyte)) from a concentration stock of 1 mM (100% DMSO ...
-
No products found
because this supplier's products are not listed.
Tianyi Zhang, et al.,
bioRxiv - Immunology 2023
Quote:
... 500 μL single-cell suspensions were incubated at 37 °C for 6 h with 5% CO2 in 48-well plates in the presence of Cell Stimulation Cocktail (Tonbo Biosciences, #TNB-4975). Stimulated cells were stained with surface markers as described above ...
-
No products found
because this supplier's products are not listed.
Jennifer G. Abelin, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Peptides were reconstituted in 3% ACN/5% FA prior to loading onto an analytical column (35 cm, 1.9µm C18 (Dr. Maisch HPLC GmbH), packed in-house PicoFrit 75 µm inner diameter ...
-
No products found
because this supplier's products are not listed.
Frederique Ruf-Zamojski, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 1 μg of a gel-purified mutagenic primer targeting mouse rs11031006 (5’-CTGGAATTTAATATTGCTCTGCCCTGTGATATTTATTTCAAGGTTAGTAGAAATGTAGCTACCTCCTGTAATGACAAATGA-3’) using PolyJet In Vitro DNA Transfection Reagent (SignaGen Laboratories). At 18 hours post transfection ...
-
No products found
because this supplier's products are not listed.
Joyce Rigal, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... flies was extracted with TRI Reagent at 5 to 6 days and 30 to 31 days old according to the manufacturers protocol (Molecular Research Center, Inc., Cincinnati, OH). To generate RNA-seq libraries ...
-
No products found
because this supplier's products are not listed.
Fiorella Ghisays, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and 0.5 µg/ml CY-3 (CCCTAA)3 (PNA BIO), denatured at 75°C for 5 minutes and incubated at room temperature for 16hr ...
-
No products found
because this supplier's products are not listed.
Tessa Acar, et al.,
bioRxiv - Plant Biology 2023
Quote:
... fresh explants were soaked in 3 x concentrated MS medium supplemented with 5% (v/v) solution of Plant Preservative Mixture (PPM, Plant Cell Technology, USA) with shaking at 100 rpm for 8 hours at 28°C (‘PPM protocol’) ...
-
No products found
because this supplier's products are not listed.
Gerrald A. Lodewijk, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... cells were seeded at 5,000-10,000 cells per cm2 and passaged every 2-3 days using Accutase (Innovative Cell Technologies, AT104).
-
No products found
because this supplier's products are not listed.
Yi Sak Kim, et al.,
bioRxiv - Neuroscience 2024
Quote:
BV-2 microglia cell line was cultured in DMEM with 5% FBS and 50 μg/ml gentamicin (Omega Scientific) as described previously5 ...
-
No products found
because this supplier's products are not listed.
Ryan M. Glanz, et al.,
bioRxiv - Neuroscience 2021
Quote:
... a pup with a visible milk band was removed from the litter and anesthetized with isoflurane gas (3–5%; Phoenix Pharmaceuticals, Burlingame, CA). A custom-made bipolar hook electrode (0.002-inch diameter ...
-
No products found
because this supplier's products are not listed.
Patrice Delaney, et al.,
bioRxiv - Genetics 2023
Quote:
... Fisher Scientific; 1327-53-3), As(V) (Arsenic V Speciation Standard, Fisher Scientfic; 7732-18-5, AsB (Arsenobetaine Standard Solution, LGC Standards; NIST-3033), DMA (Dimethylarsinic Acid Standard Solution ...
-
No products found
because this supplier's products are not listed.
Xin Lai, et al.,
bioRxiv - Systems Biology 2020
Quote:
... 1 000 U/mL IL-6 (CellGenix), 10 ng/mL TNF (Beromun ...
-
No products found
because this supplier's products are not listed.
Allison Sharrar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... C57BL/6 mouse primary hepatocytes (Cell Biologics) were thawed and plated in 96 well tissue culture plates ...
-
No products found
because this supplier's products are not listed.
Rohit Singh Rawat, et al.,
bioRxiv - Neuroscience 2022
Quote:
... isolated from hypothalamus and PFC of F0 and F1 male mice was diluted in immunoprecipitation buffer and incubated with 2 μg 5-methyl cytosine antibody (A-1014; Epigentek) at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Richard M. Johnson, et al.,
bioRxiv - Microbiology 2021
Quote:
... supplemented with 6% defibrinated sheep blood (HemoStat Laboratories) and grown at 37°C for 2-3 days ...
-
No products found
because this supplier's products are not listed.
Janin Lautenschläger, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 10 mM in DMSO and MitobloCK-6 (Focus Biomolecules) 5 mM in DMSO.
-
No products found
because this supplier's products are not listed.
Mads Kuhlmann Andersen, et al.,
bioRxiv - Physiology 2022
Quote:
... 5 μL of crude homogenate and protein standards (0 to 2 mg mL-1 bovine serum albumin, ALB001.25, Bioshop Canada, Burlington, ON, CA) was loaded into wells in triplicate followed by 250 μL of Bradford reagent (B6916 ...
-
No products found
because this supplier's products are not listed.
Jody A. Summers, Elizabeth Martinez Cano,
bioRxiv - Developmental Biology 2021
Quote:
... IL-6 was measured on duplicate samples using a commercially available chicken IL-6 ELISA kit (Aviva Systems Biology, Corp., San Diego, CA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Kelsey A. Nolden, Megan C. Harwig, R. Blake Hill,
bioRxiv - Biochemistry 2023
Quote:
... 0.02% sodium azide) using 6-8 kDa dialysis tubing (Repligen) at 4 °C overnight ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Swarna L. Vijayaraj, et al.,
bioRxiv - Immunology 2021
Quote:
... E3 (0.5 μM, 6 μl, His-cIAP1, Boston Biochem, E3-280) and 15 μl of purified FLAG-IL-1β in Ubiquitin assay buffer containing 2 mM ATP (total volume of 30 μl) ...
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Next each of 3 100ul aliquots (∼1/3 of each 24 well) of cells were processed for H3K4me3 antibody (Epicypher, #13-0041), H3K27ac antibody (Epicypher ...
-
No products found
because this supplier's products are not listed.
Jeremy Krohn, et al.,
bioRxiv - Neuroscience 2022
Quote:
... guinea pig anti perilipin-2 (Perilipin-2; 1:1000; Progen Cat# GP40, RRID:AB_2895086), mouse anti glial fibrillary acidic protein (GFAP ...
-
No products found
because this supplier's products are not listed.
Sven Klumpe, et al.,
bioRxiv - Biophysics 2021
Quote:
... 5 ug/ml Insulin (Cell Applications), 10 mM HEPES (pH 7.4) ...
-
No products found
because this supplier's products are not listed.
Yildiz Koca, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... blocked in 5% skim milk (Labscientific) and incubated with primary rabbit anti-Abl or mouse anti-NotchICD ...
-
No products found
because this supplier's products are not listed.
Hannah Wapenaar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and HRP conjugated secondary antibody, PonceauS (3% trichloroacetic acid, 3% sulfosalicylic Acid, 0.2% Ponceau) or stainfree gels (Mini-PROTEAN TGX Stain-Free Precast Gels).
-
No products found
because this supplier's products are not listed.
Ian C. Miller, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 5% human AB serum (Valley Biomedical #HP1022), 10 mM N-acetyl L-Cysteine (Sigma #A9165) ...
-
No products found
because this supplier's products are not listed.
Antonella Scaglione, et al.,
bioRxiv - Immunology 2021
Quote:
... SARS-CoV-2 spike (BPS Bioscience) and p24 (Abcam ...
-
No products found
because this supplier's products are not listed.
Anna C. Deleray, et al.,
bioRxiv - Bioengineering 2023
Quote:
... 2-hydroxyethyl starch (Spectrum Chemical, H3012) was used.