Labshake search
Citations for GenScript :
4851 - 4900 of 6194 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... Endotoxin concentration was determined using the ToxinSensorTM Chromogenic LAL Endotoxin Assay Kit (Genscript, NJ). All protein used for immunization had final endotoxin levels below 10 EU/ml ...
-
bioRxiv - Developmental Biology 2020Quote: vash-1 full length cDNA (EMSEMBL ENSDART00000143819.3) was designed and synthesised by GenScript. TA overhangs were added by incubating the insert for 10 min at 72 °C with 50mM DNTPs and Taq polymerase (NEB) ...
-
bioRxiv - Developmental Biology 2020Quote: ... custom made rabbit anti-chick MMP13 antibody (1μg/ml, Genscript), rabbit anti-CXCL14 (0.2 μg/ml ...
-
bioRxiv - Developmental Biology 2020Quote: ... and rabbit polyclonal anti-pSer10 (GenScript, A00339). Secondary antibodies (with minimal species cross reactivity ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 µg/ml rabbit anti-chick MMP13 custom-made primary antibody (GenScript, Piscataway ...
-
bioRxiv - Microbiology 2020Quote: ... Rabbit antibodies against an N-terminal peptide (IPIKDMEVDVEQIA) and a C-terminal peptide (GIPNEERSVTSQTE) of CgRad53 were raised by Genscript (https://www.genscript.com). To help detect CgRad53 by Western blot ...
-
bioRxiv - Immunology 2020Quote: ... Peptides were synthesised by Genscript (USA) using Fmoc solid phase chemistry.
-
bioRxiv - Molecular Biology 2020Quote: Specific treatment conditions were as follows: GPCR activation – Cells were treated with α-factor peptide hormone (Genscript) at 3μM final concentration ...
-
bioRxiv - Molecular Biology 2020Quote: Commercial synthetic Ste18Nt peptides were synthesized with N-terminal acetylation and C-terminal amidation and various combinations of S3 and S7 phosphorylation (or non-phosphorylated) and enriched to 95% purity (Genscript). Lyophilized peptides were reconstituted in deionized water at a concentration of 2.5 mg/ml and further diluted as necessary with 10mM potassium phosphate buffer (pH 7) ...
-
bioRxiv - Molecular Biology 2020Quote: Peptides were ordered from GenScript (www.genscript.com) at > 98 % purity ...
-
Integrated requirement of non-specific and sequence-specific DNA binding in MYC-driven transcriptionbioRxiv - Molecular Biology 2020Quote: ... were expressed in the pET-3a plasmid (Genscript) and purified from the BL21 (DE3 ...
-
bioRxiv - Molecular Biology 2020Quote: ... vipp1 from Genscript was PCR amplified as described above for desD and desB to enable directional cloning of the PCR product into pENTR/SD/D-topo.
-
bioRxiv - Molecular Biology 2020Quote: ... the desB sequence from GenScript was amplified by PCR to introduce a HindIII site plus a ribosome-binding site on the 5’ end and an Asc1 restriction site on the 3’ end ...
-
bioRxiv - Molecular Biology 2020Quote: HCoV-19 S gene (virus isolate: Wuhan Hu-1; GenBank number QHD43416.1) was synthesized (Genscript) with codons optimized for insect cell expression ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA probes (Table S1) were synthesized and labeled with 6-FAM at the 5’ end by GenScript (Nanjing, China). For the RNA electrophoresis mobility shift assays (REMSAs) ...
-
bioRxiv - Molecular Biology 2020Quote: ... anti-GFP (1:1000) (GenScript, A01704) anti-MRG-1 (1:1000 ...
-
bioRxiv - Molecular Biology 2020Quote: cDNA of mouse Tia1 was purchased from GenScript in pcDNA3.1 vectors (clone ID ...
-
bioRxiv - Biochemistry 2020Quote: ... The DnaJB8F→S construct was purchased from Genscript and cloned into pET-29b ...
-
bioRxiv - Molecular Biology 2020Quote: ... Polyreactivity was quantified by detecting bound IgG using an HRP-conjugated anti-human IgG secondary antibody (Genscript) and SuperSignal ELISA Femto Maxiumum Sensitivity Substrate (Thermo Scientific) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Flag antibody was purchased from GenScript. PPP2CA (I3482-I-AP) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Flag affinity beads (Genscript) or HA magnetic beads (Bimake ...
-
bioRxiv - Molecular Biology 2020Quote: ... Codon-optimized nucleotide sequences encoding orthologues of human SM-N100 were previously obtained from GenScript [7] ...
-
bioRxiv - Molecular Biology 2020Quote: The E2-Crimson-human HSD11B1 gene (variant 1) was synthesised by GenScript in vector pUC57 ...
-
bioRxiv - Molecular Biology 2020Quote: ... synthesized by GenScript, and A/Chicken/Jalisco/12283/12 H7N3 (a kind gift from Florian Krammer ...
-
bioRxiv - Molecular Biology 2020Quote: Codon optimized Gcn5 (S. pombe) with 1 × FLAG was cloned into pET28a in frame with N terminal 6 × HIS tag by GenScript to generate JP-2587.
-
bioRxiv - Molecular Biology 2020Quote: ... The remodeled plasmid (pAKD01) was custom synthesized by Genscript. For proper disulfide bridge formation ...
-
bioRxiv - Molecular Biology 2020Quote: ... The mSpCas9-MLS construct was synthesized by GenScript (NJ, USA) using their OptimumGene™ - Codon Optimization algorithm.
-
bioRxiv - Molecular Biology 2020Quote: ... The selected sgRNA with additional 20 bp RP-loop [5’TCTCCCTGAGCTTCAGGGAG-3’] at the 5’ end of guide RNA was custom synthesized by Genscript, cloned into plasmid pUC57 with unique restriction sites (Pcil ...
-
bioRxiv - Molecular Biology 2020Quote: ... rabbit anti-V5 (GenScript, 1:500 dilution), rabbit anti-HA (Cell Signaling ...
-
bioRxiv - Genomics 2020Quote: ... or synthesized by Genscript. Gene fragments used for PCR were purchased as mammalian codon-optimized gene fragments from IDT ...
-
bioRxiv - Genomics 2020Quote: ... An antibody to CENH3 was custom-produced by GenScript (Piscataway, NJ, USA) against a peptide designed based on the C ...
-
bioRxiv - Microbiology 2020Quote: ... following the manufacturer’s instructions and sequenced by Genscript Inc ...
-
bioRxiv - Genomics 2020Quote: Genomic DNA from the HEK293 cell line was purchased from GenScript (https://www.genscript.com).xs
-
bioRxiv - Biochemistry 2020Quote: ... Plasmids pRS315-trx1C34S-ProtA and pRS315-trx2C31SC34S-ProtA were constructed by site-directed mutagenesis of plasmid pRS315-TRX2-ProtA (GenScript). The correct sequence of all plasmids constructed was verified by sequencing.
-
bioRxiv - Immunology 2020Quote: ... with complete RPMI (10%FBS, 1% Pen/Strep, 50uM b-mercaptoethanol) supplemented with 1ug/ml OVA Peptide (323-339) (Genscript, Cat. No. RP10610) (DAY0) ...
-
bioRxiv - Biochemistry 2020Quote: The DNA coding for the human LRRK1 residues 28 to 2015 (OHu72031 from Genscript) was PCR-amplified using the forward primer TACTTCCAATCCATGGAGACGCTTAACGGTGCCGGGGAC and the reverse primer TATCCACCTTTACTGCTTTACCTTCTCTTGCGAGTGCAAGC ...
-
bioRxiv - Genomics 2020Quote: ... Pachón and Tinaja genomes were amplified from genome or synthesized commercially (GenScript) and cloned into pGL4.23 (Promega ...
-
bioRxiv - Biochemistry 2020Quote: ... expression vector with an N-terminal His6-tag and a TEV protease recognition site for removal of the tag (GenScript; Piscataway, NJ). In addition ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were blocked with 5% milk in PBS+0.1%Tween-20 and probed with anti-EnvP sera or mouse anti-GAPDH antibody (Genscript), followed by goat anti-mouse HRP (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: Human EnvP(b)1 codon-optimized sequence was ordered from GenScript. EnvP(b)1 sequences from chimpanzee ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were stained with mouse anti-HA antibody (Genscript) diluted 1:500 in PBS supplemented with 0.5% goat serum and 0.01% Tween-20 (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... The samples were then heated for 5 minutes at 85°C and separated by SDS-PAGE and analyzed by Western blot using rabbit anti-GST antibody (Genscript), rabbit α-RSV CA ...
-
bioRxiv - Microbiology 2020Quote: ... with all lysine residues predicted facing the cytoplasm mutated (TbAQP25K>R) was designed and synthesized by GenScript and verified by sequencing ...
-
bioRxiv - Immunology 2020Quote: ... were synthesized by Genscript Inc (Piscataway ...
-
bioRxiv - Immunology 2020Quote: ... synthesized in vitro and subcloned into a pcDNA3.4 vector containing the human IgG1 Fc region by a commercial partner (Genscript). Transfection grade plasmids were purified by maxiprep and transfected into a 293-6E expression system ...
-
bioRxiv - Cell Biology 2020Quote: ... used our new entry vector pDONR_p1-p3 (synthesized by Genscript, U.S.A.). All new constructs have been made available from Addgene and are listed in Supplementary Table 1.
-
bioRxiv - Biophysics 2020Quote: ... LC3C/B) and the GFP-tagged double mutants (GFP-LC3A-EE, GFP-LC3B-AK) were obtained by subcloning (synthesized by GenScript, Piscataway, NJ).
-
bioRxiv - Biochemistry 2020Quote: ... was synthesized (Genscript, Piscataway, NJ) and cloned into the LAI molecular clone backbone using Sal1 and BamH1 ...
-
bioRxiv - Biochemistry 2020Quote: ... where obtained from Genscript in a pUC57 cloning vector ...
-
bioRxiv - Plant Biology 2020Quote: ... coli and de novo synthesized (Genscript) including a five amino acid long C-terminal linker sequence and an eight amino acid long His-tag ...