Labshake search
Citations for GenScript :
4701 - 4750 of 6194 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... Plasmids pMO1 (napBC) and pMO2 (cymA, cctA) were procured from GenScript using the pSB1ET2 plasmid as the backbone ...
-
bioRxiv - Microbiology 2021Quote: ... mEos3.2 from Genscript (The Netherlands) and DamX from the E ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant murine GM-CSF protein was purchased from GenScript. Therapeutic anti-CTLA4 (clone 9H10 and 9D9 ...
-
bioRxiv - Microbiology 2021Quote: ... and SIR2-HerA were synthesized by Genscript Corp ...
-
bioRxiv - Microbiology 2021Quote: ... produced and purified (GenScript Biotech). Mouse polyclonal anti-SARS-CoV-2 Sst serum was produced as followed ...
-
bioRxiv - Immunology 2021Quote: Untagged SARS-CoV-2 spike protein (GenScript) containing the S1/S2 boundary furin site was coated onto the high protein binding ...
-
bioRxiv - Immunology 2021Quote: ... The DNAs for both antigen candidates were individually synthesized with their codon use optimized for translation in Pichia pastoris and ligated into pPICZαA using the EcoRI and XbaI restriction sites (GenScript). The recombinant plasmids were electroporated into P ...
-
bioRxiv - Microbiology 2021Quote: ... His-tagged AtxA was detected using anti-His antibody (GenScript USA Inc., Piscataway, NJ, USA). RNA polymerase subunit β was used as a loading control and detected using anti-RNAP antibody (Thermo fisher ...
-
bioRxiv - Microbiology 2021Quote: ... and anti-RFP (1:3000 dilution, GenScript), anti-Dpm1 (1:3,000 dilution ...
-
bioRxiv - Immunology 2021Quote: ... Transgene cDNAs were purchased from Genscript, choosing the canonical (longest ...
-
bioRxiv - Microbiology 2021Quote: ... or CaTpk2 rabbit polyclonal antibody (GenScript), at 1:1,000 dilution in 5% nonfat dry milk in TBS-T buffer plus 0.5% sodium azide for 2 hours at room temperature ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were exposed to Spike-RBD protein (Genscript) (5 μg/mL) ...
-
bioRxiv - Immunology 2021Quote: ... phCMV1 (GenScript, Netherlands), or pEVAC plasmids (GeneArt ...
-
bioRxiv - Genetics 2021Quote: ... HDR templates were ordered in dsDNA form (plasmids) from GenScript or Genewiz ...
-
bioRxiv - Microbiology 2021Quote: ... 0.2% Tween-20) for 30 min and probed with CaBcy1 rabbit polyclonal antibody (GenScript) or CaTpk2 rabbit polyclonal antibody (GenScript) ...
-
bioRxiv - Immunology 2021Quote: ... and synthesized from GenScript. mAbs were expressed in FreeStyle 293F or Expi293F mammalian cells (ThermoFisher ...
-
bioRxiv - Immunology 2021Quote: ... All heparinases used were purified away from endotoxins using an Endotoxin Removal Kit from GenScript (L00338)66.
-
bioRxiv - Microbiology 2021Quote: A HMPV minigenome plasmid containing Gaussia/Firefly luciferases was designed and synthesized by Genscript, cloned in pUC57 vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... The sequence was chemically synthesized (GenScript) and cloned into a derivative of the lentiviral vector ...
-
bioRxiv - Developmental Biology 2021Quote: ... The loaf sgRNA sequences GCTGGTGATTACGTCGGTGA (loaf gRNA 1) and TGCGGGACCATCCGGGTACC (loaf gRNA 2) identified on www.flyrnai.org/crispr2 were made with gene synthesis in pUC57 (GenScript) and cloned into pCFD4 (Port et al ...
-
bioRxiv - Immunology 2021Quote: ... All other peptides were 13 amino acids overlapping by 11 amino acids and were synthesized by GenScript. The peptides covering the envelope (E) ...
-
bioRxiv - Immunology 2021Quote: ... Two gBlock gene fragments were synthesized by Genscript to encode the modified TCRα chain ...
-
bioRxiv - Cell Biology 2021Quote: Peptides used in fluorescence polarization assays were synthesised by Genscript and are shown in Table 1 ...
-
bioRxiv - Cell Biology 2021Quote: The open reading frame of GPR3 cDNA (Genscript) and SIK2 40 was cloned into a modified version of pLenti6/V5-DEST vector (Invitrogen ...
-
bioRxiv - Genomics 2021Quote: ... The codon-optimized Bxb1 gene was purchased from Genscript and can be found in Supplementary Sequence 2 ...
-
bioRxiv - Genomics 2021Quote: ... human Hek293 DNA was purchased from Genscript. S ...
-
bioRxiv - Genomics 2021Quote: ... and C1 Core DNA fragments (Supplemental Table S5) were synthesized by Genscript USA (Piscataway ...
-
bioRxiv - Genomics 2021Quote: ... The following antibodies were used: Gcn5 (rabbit polyclonal, 1:1000, (GenScript antibody services ...
-
bioRxiv - Genomics 2021Quote: ... The capturing antibody (rabbit FL Gcn5 (Genscript), rat high affinity anti HA (MilliporeSigma 11867423001) ...
-
bioRxiv - Genomics 2021Quote: ... Ada2b (rabbit polyclonal, 1:1000; GenScript anti-amino-acid 1-330); anti-Flag-horseradish peroxidase (mouse ...
-
bioRxiv - Genomics 2021Quote: ... purchased from Genscript (NM_000228.3) and GFP-bGH sequence from Addgene (Plasmid #11154) ...
-
bioRxiv - Genomics 2021Quote: ... H2A.X and H2A.Z antibodies are affinity-purified rabbit polyclonal antibodies made by GenScript USA Inc (Piscataway ...
-
bioRxiv - Cell Biology 2021Quote: ... Anti-peptide antibodies against CHMP7 pSer3 (3891 and 3892) were generated by immunisation of rabbits with KLH-conjugated peptides (MWpSPEREAEAPAGGC) by GenScript Biotech (Netherlands ...
-
bioRxiv - Cell Biology 2021Quote: ... the mouse anti-FLAG was from Genscript (Nanjing, Jiangsu). FITC-conjugated goat anti-mouse ...
-
bioRxiv - Cell Biology 2021Quote: ... Anti-FLAG agarose beads and streptavidin-affinity magnetic beads were from Genscript (Nanjing, Jiangsu); Protein A/G magnetic beads were from Thermo Fisher Scientific.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: The plasmid pcDNA3 encoding ACE2 was obtained from GenScript (OHu20260); the plasmid encoding prolactin (PRL ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The plasmid pcDNA3 encoding ACE2-Flag was obtained from GenScript (OHu20260) and pcDNA3 encoding ACE2-SBP-6xHis was obtained from Thermo Fisher Scientific.
-
bioRxiv - Biophysics 2021Quote: ... and 10 μM vasopressin (GenScript) for 1.5 h at room temperature (RT) ...
-
bioRxiv - Immunology 2021Quote: ... The lysate was immunoprecipitated using designated primary antibodies with protein G resin (GenScript, Piscataway, NJ), or anti-Flag M2 affinity agarose gel at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... CD8+ T cell lines were stimulated with cognate peptide pools or 10µM individual peptides (Genscript) and incubated for 5 hours in the presence of GolgiPlug (BD Biosciences) ...
-
bioRxiv - Immunology 2021Quote: ... using IgE-SARS-CoV-2 S plasmid variants (Genscript) co-transfected with pNL4-3.Luc.R-E-plasmid (NIH AIDS reagent ...
-
bioRxiv - Immunology 2021Quote: ... Variant peptide pools (GenScript, custom) included the following changes to match published deletions/mutation in each variant ...
-
bioRxiv - Immunology 2021Quote: ... respectively) were synthesized (Supplementary Table 11) and cloned into the expression vector pET22b (GenScript). An interchain disulfide (CαCys158–CβCys171 in RLQ3 ...
-
bioRxiv - Immunology 2021Quote: ... HLA-A0101), NSP13-242 (TLVPQEHYV, HLA-A0201), NSP13-134 (KLFAAETLK, HLA-A0301), NSP13-400 (VYIGDPAQL, HLA-A2402) (all purchased from Genscript, NJ, USA) in PBS/HSA ...
-
bioRxiv - Immunology 2021Quote: RBD end-point titers were determined using standard ELISA and plates were coated with 500 ng/mL SARS-CoV-2 Spike-protein Receptor-Binding Domain (RBD) (GenScript, Piscataway NJ) Heat inactivated plasma (1:50 in blocking buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... Variants of CMV-ubi-nsP4-RRV and CMV-ubi-nsP4-SINV containing mutations listed in supplementary figure S6 were constructed using synthetic DNA fragments (Genscript). Sequences of all plasmids were verified using Sanger sequencing and are available from the authors upon request.
-
bioRxiv - Molecular Biology 2021Quote: ... Synthetic constructs were manufactured by Genscript (Piscataway, NJ, USA) and inserted into the pET-21b(+ ...
-
bioRxiv - Molecular Biology 2021Quote: ... synthesized as fragments (GenScript), and cloned into the pCDFDuet-1 backbone under control of an IPTG-inducible T7 promoter.
-
bioRxiv - Molecular Biology 2021Quote: ... pS23-Ab 1:10,000 (Custom generated by GenScript; peptide sequence-CKILTHYENDSPTDLR). The cells were washed and incubated with secondary antibodies Alexa fluor 488 goat anti-mouse (Thermo fisher ...
-
bioRxiv - Microbiology 2021Quote: ... coli AW1.7 were also synthesized and cloned by Genscript. All synthesized sequences are presented in Table S5 ...