Labshake search
Citations for GenScript :
4751 - 4800 of 6194 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: The entire Ddi1 expression construct was ordered from GenScript and contained the PfDdi1 gene recodonised to E ...
-
bioRxiv - Biophysics 2021Quote: The following proteins and peptides are chemically synthesized from GenScript, USA ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit polyclonal short XIRP2 antibody (custom generated against the immunizing peptide NSKRQDNDLRKWGD, Genscript, 1:100), mouse monoclonal IgG1 γ-actin antibody (1-24 ...
-
bioRxiv - Cell Biology 2021Quote: ... Lysate was flowed over an Anti-FLAG resin (GenScript, Piscataway, NJ, US, L00432) column at 1 mL/min ...
-
bioRxiv - Neuroscience 2021Quote: ... An ELISA titer of over 1:128,000 and target protein binding were validated by immunoprecipitation and western blotting using the positive control with protein immunogen by GenScript. The final product was 0.5 ml of pre-immune serum at 1.5-6 mg/rabbit and 1 mg of the requested peptide.
-
bioRxiv - Immunology 2021Quote: ... and B.1.617.2+ SARS-CoV-2 RBD construct were synthesized by GenScript into pCMVR with an N-terminal mu-phosphatase signal peptide ...
-
bioRxiv - Immunology 2021Quote: ... The SARS-CoV-2 S ectodomain with hexapro mutations and P.1 spike mutations (L18F, T20N, P26S, D138Y, R190S, K417T, E484K, N501Y, D614G, H655Y, T1027I, and V1176F) was synthesised by GenScript into pCMVR with foldon ...
-
bioRxiv - Immunology 2021Quote: ... The SARS-CoV-2 S ectodomain with the 2P mutations and B.1.1.7 spike mutations (del69/70, del144/145, N501Y, A570D, D614G, P681H, T716I, S982A, and D1118H) was synthesised by GenScript into pCMV with a C-terminal foldon and avi tag followed by an octa-histidine tag ...
-
bioRxiv - Immunology 2021Quote: ... and B.1.617.2 spike mutations (T19R, G142D, E156G, T478K, and D950N substitutions and a deletion of residues 157 and 158) was synthesised by GenScript into pCMV with a C-terminal avi tag followed by an octa-histidine tag ...
-
bioRxiv - Immunology 2021Quote: ... and B.1.617.1 spike mutations (T95I, G142D, E154K, L452R, E484Q, D614G, P681R and Q1071H) was synthesised by GenScript into pCMV with a C-terminal foldon and avi tag followed by an octa-histidine tag ...
-
bioRxiv - Immunology 2021Quote: ... The SARS-CoV-2 S ectodomain with the 2P mutations and B.1.351 spike mutations (D80A, D215G, 242-244del, R246I, K417N, E484K, N501Y, D614G, and A701V) was synthesised by GenScript into pCMV with a C-terminal foldon and avi tag followed by an octa-histidine tag.
-
bioRxiv - Cell Biology 2021Quote: ... (5) was synthesized by GenScript and subsequently subcloned into the respective restriction sites of pcDNA4/TO-CLC7-Y715C ...
-
bioRxiv - Immunology 2021Quote: ... The gene encoding the Spike protein of SARS-CoV-2 (UniProt P0DTC2) codon-optimized for expression in CHO cells was synthesized by Genscript (Piscataway, NJ, USA). The optimized DNA fragment was cloned in the expression vector to create pCNeoMEM-S ...
-
bioRxiv - Cancer Biology 2021Quote: ... a fragment corresponding to CIP2A (1-560) was cloned by Genscript into pGADT7 AD (Clontech/Takara ...
-
bioRxiv - Immunology 2021Quote: Peptides were synthesized by Genscript or A&A Labs with ...
-
bioRxiv - Molecular Biology 2021Quote: ... and CV3018 heavy and light chains were ordered from GenScript and cloned into pCMV/R ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmids for alpha-actinin-4 FRET-based tension sensors were synthesized and sequenced by Genscript. Alpha-actinin-4 sstFRET408 was constructed by inserting the sstFRET module between 408aa and 409aa of human alpha-actinin-4 (XP_016882820.1) ...
-
bioRxiv - Plant Biology 2020Quote: The Wx1 transit peptide translational fusions with Pgd1 and Pgd2 were synthesized by GenScript. The Wpgd1 and Wpgd2 fusion genes as well as Pgd1 and Pgd3 ORFs were cloned in pGEM3Z (Promega) ...
-
bioRxiv - Plant Biology 2020Quote: ... we synthesized the OsVST1 cDNA sequence (GenScript) to include attL1/L2 sites for direct gateway Recombination recombination into pGWB502-omega (Nakagawa et al. ...
-
bioRxiv - Microbiology 2020Quote: ... coli and cloned into the IPTG inducible vector pET20b fused to a C-terminal His6-tag (a service provided by Genscript). This vector was transformed into E ...
-
bioRxiv - Microbiology 2020Quote: ... the recombinant protein of the extracellular domain of human ACE2 (aa 1-740) fused to Fc (ACE2-Fc, Genscript, Nanjing, China) was coated on 96-well microtiter plate (50 ng/well ...
-
bioRxiv - Microbiology 2020Quote: ... the recombinant protein ACE2-Fc (Genscript) at 5 μg/mL buffered in PBST (PBS with 0.02% Tween 20 ...
-
bioRxiv - Microbiology 2020Quote: ... 50 ng of His-tagged RBD (His-RBD, aa 319-541) (Genscript) was then added to each well and incubated at 37°C for 2 hours ...
-
bioRxiv - Plant Biology 2020Quote: ... coli (Supplementary Table 4) and synthesized by GenScript (Piscataway, NJ). The Arabidopsis THI4 sequence was the native cDNA ...
-
bioRxiv - Plant Biology 2020Quote: ... were synthesized (GenScript, Piscataway, NJ, USA), using the first 200 - 300 bases of the ORF of each gene ...
-
bioRxiv - Plant Biology 2020Quote: ... either a 100 nM solution of flg22 immunogenic flagellin peptide (GenScript), or a 0.2% solution of chitin (method2 from [89]) ...
-
bioRxiv - Plant Biology 2020Quote: ... the 500 bp 3’sequences from AT1G76560 (wild-type and mutated) and AT1G03160 flanked by attR1 and attR2 sites were synthesized and inserted in the pUC57 plasmid by Genscript. The DNA insert was then shuttled by Gateway cloning into the dual-luciferase vector nLucFlucGW (Genbank MH552885 ...
-
bioRxiv - Plant Biology 2020Quote: ... and probed with HRP-conjugated mouse anti-rabbit (1:10,000, Genscript, #A01856) and horse anti-mouse (1:5000 ...
-
bioRxiv - Plant Biology 2020Quote: ... and redLUC-*F2A-gLUC were synthesized in pUC57 cloning vectors (Genscript) using KpnI - SacI ...
-
bioRxiv - Plant Biology 2020Quote: ... and detected with anti-Myc antibodies (Genscript, #A00704 www.genscript.com) and ECL Plus chemiluminescent substrate (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: ... peptides were synthesized that corresponded to amino acids 439 through 459 surrounding the TOR substrate T449 in AtS6K1 (At3g08730.1) with either threonine or phosphothreonine at T449 (DPKANPFTNFTYVRPPPSFLH or DPKANPFTNFpTYVRPPPSFLH) and conjugated to either BSA or KLH (GenScript). BSA-conjugated phosphopeptide was used to immunize mice ...
-
bioRxiv - Plant Biology 2020Quote: ... plants were first syringe infiltrated with 1 μM flg22 (GenScript), 1 μM flgII-28 (EZBiolab) ...
-
bioRxiv - Microbiology 2020Quote: Purified proteins were submitted to SDS-PAGE using SurePAGE (Genscript). Fluorescence detection in gel electrophoresis (Figure S1A ...
-
bioRxiv - Microbiology 2020Quote: ... samples were added in duplicate (100μl/well) followed by the addition of the anti-human IgG-Fc-HRP (GenScript No. A01854) conjugate (diluted 1:10,000 ...
-
bioRxiv - Biochemistry 2020Quote: The full-length DNA insert for PX-Gal3 and PX-Gal3Δ116 were synthesized by Genscript (New Jersey, USA). Starting from the human galectin-3 cDNA sequence ...
-
bioRxiv - Biochemistry 2020Quote: ... ATG7 and ATG10 were codon optimised for Sf9 insect cell expression system and synthetic genes were purchased from GenScript. (10xHis-TEVcs-)ATG16L1-GFP(-TEVcs-StrepII ...
-
bioRxiv - Biophysics 2020Quote: ... a pET28(+) expression vector was produced by Genscript (Piscataway, NJ) to express the 101-amino acid (aa ...
-
bioRxiv - Biophysics 2020Quote: Synthetic PAP248-286 was purchased from Genscript and New England Peptides ...
-
bioRxiv - Biophysics 2020Quote: ... Region +95 to +374 containing (linker-Spinach 2-linker-Spinach 2-linker) was synthesized by GenScript as double stranded DNA delivered on a pUC57 plasmid ...
-
bioRxiv - Biophysics 2020Quote: ... using EcoRI and XbaI restriction sites (Genscript). The insert was further cloned into pcDNA3.4 using the HiFi DNA Assembly Kit (New England Biolabs ...
-
bioRxiv - Biophysics 2020Quote: ... His-tag and Strep-tag was codon optimized for mammalian expression (Genscript) and inserted into pFastBac1 (Thermo Fisher ...
-
bioRxiv - Biophysics 2020Quote: The cDNA sequences for the protein variants used in the study were purchased from GenScript and the proteins were N-terminally tagged with a 6xHis-Lipo domain ...
-
bioRxiv - Biophysics 2020Quote: ... coli (GenScript, New Jersey, USA). Plasmids containing just the intrinsically disordered region of avian ANP32A (avIDD ...
-
bioRxiv - Biophysics 2020Quote: ... via NdeI and BamHI were obtained from Genscript. Enzymes were expressed in E ...
-
bioRxiv - Biophysics 2020Quote: The peptide with 25 repeats of proline-arginine (PR25) was purchased from GenScript (Hong Kong). PR25 was dissolved in water and then mixed with polyU at final concentration 100 μM and 1 μg/μl respectively to induce the LLPS.
-
bioRxiv - Biophysics 2020Quote: ... Lysine-Cysteine-Lysine-Deca-histidine peptide was purchased from GenScript. Purified mouse CD45RABC extracellular domain with a C-terminal 6-His tag (accession # ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... rosetta synaptobrevin a codon-optimised nucleotide sequence encoding the soluble portion of the protein [Syb (1-75)] was prepared by gene synthesis (Genscript, USA): GAGGCGAACCGTACCGGTGACTACCGTCTGCAGGAAGCGCAGCGTCAAGTGGGCGAAGTT CAAAACGTGATGCGTGATAACCTGACCAAGGTTATCGAGCGTGGTGAAAAACTGGACGATC TGGACGCGAAGGCGGAAGATCTGGAGGCGGAGGGTCAGCGTTTCCAAAACCGTGCGGGCC GTCTGCGTCGTCAGATGTGGTGGCAAAACAAACGTAACCAGTAA
-
bioRxiv - Cell Biology 2020Quote: ... Purified GST peptide was purchased from Genscript (catalog number 202039). Purified GST-tagged LC3 protein was purchased from Ubiquigent (catalog number 60-0111-500) ...
-
bioRxiv - Microbiology 2020Quote: ... mouse anti-RHDV RdRp was prepared by Genscript and stored in our laboratory ...
-
bioRxiv - Microbiology 2020Quote: ... Full-length PbCSP and PbCSP-derived peptides (GenScript) were diluted in Tris-buffered saline (TBS ...