Labshake search
Citations for GenScript :
3901 - 3950 of 6194 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: Human SNX1 and SNX2 peptide sequences were synthesized by Genscript (USA). To obtain the peptide stock solutions at neutral pH ...
-
bioRxiv - Cell Biology 2021Quote: ... R498D and K501D were cloned into the pET-28a vector by GenScript® and codon optimised for bacterial protein expression ...
-
bioRxiv - Cell Biology 2021Quote: ... the pWPIR-GFP backbone was used and modified by Genscript to reach full-length FOXO3a pWPIR-FOXO3aWT-GFP and mutant forms pWPIR-ΔCR1-GFP ...
-
bioRxiv - Cell Biology 2021Quote: The antibodies used were: monoclonal anti-His THE HIS Tag (GenScript, Piscataway, NJ); monoclonal anti-HA (BioLegend ...
-
bioRxiv - Plant Biology 2021Quote: ... flg2246 and csp2232 were purchased from Genscript Inc ...
-
bioRxiv - Synthetic Biology 2021Quote: ... were synthesized and cloned in the pUC57 plasmid (GenScript, United States). Linear templates were generated by PCR using forward and reverse primers 5’-CAGTCACGACGTTGTAAAACGAC-3’ and 5’-CACACAGGAAACAGCTATGAC-3’ ...
-
bioRxiv - Synthetic Biology 2021Quote: ... coli or yeast and synthesized by GenScript (Piscataway, NJ) or Twist Biosciences (San Francisco ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and XbaI restriction sites (Supplementary Information) (Genscript). The ermE*p promoter fragment was restriction digested with EcoRI/PstI and ligated into the EcoRI/PstI sites of pSB1C3 ...
-
bioRxiv - Systems Biology 2021Quote: ... quadricauda predicted PGS protein (Genscript, www.genescript.com), and anti-Rubisco goat antiserum (diluted 1:3000 ...
-
bioRxiv - Systems Biology 2021Quote: ... reinhardtii CDKB1 protein (Genscript, www.genescript.com)(64) ...
-
bioRxiv - Systems Biology 2021Quote: ... cell were stained overnight at 4°C with SARS-CoV-2 N-antibody (Genscript) at a dilution of 1:500 in PBS + 1% BSA+ 1%FBS ...
-
bioRxiv - Plant Biology 2021Quote: ... goat polyclonal anti-HA (GenScript, cat. no. A00168), rabbit polyclonal anti-GFP (Abcam ...
-
bioRxiv - Plant Biology 2021Quote: ... were synthesized by Genscript Biotech (Piscataway ...
-
bioRxiv - Plant Biology 2021Quote: ... The filtered supernatant was mixed with 2 mL slurry of previously washed and equilibrated Glutathione Sepharose 4B beads (GenScript). After incubation ...
-
bioRxiv - Microbiology 2021Quote: A cloning shuttle vector for large fragments was constructed by Genscript Corp ...
-
bioRxiv - Microbiology 2021Quote: ... The FRET-pair substrate Abz-LPETG-Dap(Dnp)-OH (Genscript, Piscataway, NJ, Unites States) and the tetraglycine (Sigma Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... anti-SpoVAD64 (1:10,000) and anti-His (1:4,000) (GenScript) antibodies ...
-
bioRxiv - Microbiology 2021Quote: ... synthesized and cloned into the Gal-inducible plasmid pESC-URA by GenScript (Piscataway, NJ). Briefly ...
-
bioRxiv - Microbiology 2021Quote: Fluorescent-tagged phage proteins were synthesized into pDSW206 by Genscript and delivered as lyophilized plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... Point mutation variations of this initial construct were subsequently modified by Genscript from this original template ...
-
bioRxiv - Microbiology 2021Quote: ... The plasmid pModProm1-TiR1-TY1-3DHFR (DNA sequence in Supplementary Table 5 was DNA synthetized and then cloned in pUC57 simple by Genscript. The chimeric construct was inserted within the UPRT locus ...
-
bioRxiv - Microbiology 2021Quote: Gene synthesis for all insect cell codon optimized constructs was provided by Genscript. The original T ...
-
bioRxiv - Microbiology 2021Quote: ... and ChIP (Genscript >95% purity) was dissolved in H2O ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 St containing 2X-StrepTag at the C-terminal region was commercially synthesized as mentioned above (GenScript Biotech). SARS-CoV-2 N ...
-
bioRxiv - Microbiology 2021Quote: ... was used as an immunogen in New Zealand rabbits and custom-generated by Genscript Inc ...
-
bioRxiv - Biochemistry 2021Quote: ... synthesized (Genscript, NJ, USA), and cloned into the NheI/NotI sites of the pET-28a(+ ...
-
bioRxiv - Microbiology 2021Quote: ... Both targeting constructs were synthesized by Genscript. Properly targeted ES cell clones were confirmed using PCR screening of the 5’ and 3’ arms of homology and the entire targeted knock-in was PCR amplified for Sanger sequencing prior to microinjection into V6.5 ES cells ...
-
bioRxiv - Genetics 2021Quote: The eG-SCON-FP and eG-DECAI-FP cassettes were synthesized and ordered from Genscript, and subsequently cloned into the pcDNA4TO construct with BamHI (R0136S ...
-
bioRxiv - Genetics 2021Quote: eGFP cDNA containing the SapI recognition sites at the selected intron insertion site was synthesized and ordered from Genscript and cloned into pcDNA4TO construct with BamHI and XhoI ...
-
bioRxiv - Genetics 2021Quote: ... sgRNA (50 ng/μl) and ssODN (20ng /μl, Genscript). The mixture was spun down in a tabletop centrifuge at 13,000g at 4 °C for 15-20 minutes to prevent clogging of the injection needles ...
-
bioRxiv - Immunology 2021Quote: ... Plates were washed three times with PBS-T (PBS with 0.1% Tween-20) and 50 μl of HRP anti-Human IgG Antibody (GenScript #A00166) diluted 1:5000 in dilution solution were added to each well ...
-
bioRxiv - Immunology 2021Quote: ... DH1017.IgG and DH1017.Fab heavy and light chain plasmids (GenScript) were co-transfected at an equal ratio in suspension Expi 293i cells (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... The bidirectional CXCR6 overexpression vector was generated by cloning the CXCR6 cDNA amplified from Genscript Accession No ...
-
bioRxiv - Immunology 2021Quote: ... and 1 mg/mL MOG35-55 peptide (Genscript). Mice were immunized on both flanks by subcutaneous injection of the emulsion for a total of 200 µL ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting cyk-1/Formin cDNA was synthesized (Genscript). In addition ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... This 338aa protein fragment was then expressed in E.coli and used to immunize two rabbits for antibody production by GenScript. ELISA titer > 1:128,000 and target protein fragment binding validation by western blot and cell line overexpression.
-
bioRxiv - Genomics 2021Quote: ... Chicken (A00729-40, GenScript).
-
bioRxiv - Microbiology 2021Quote: ... The anti His-tag mouse antibody was from GenScript (cat no. A00186). Horseradish peroxidase-conjugated rabbit anti-mouse antibody was from Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: Codon-optimized full-length open reading frames of the S genes of SARS-COV-2 variants were cloned into pcDNA3.1(+) or pVRC8400 by GenScript (Piscataway, NJ). The spikes of variants used in this study were listed in Table 1 ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Microbiology 2021Quote: The synthetic gene encoding the BT_1526 ORF (wild type) was ordered from Genscript cloned into a pET-28a expression plasmid with a six-histidine tag at the N-terminus ...
-
bioRxiv - Microbiology 2021Quote: ... Recombinant baculoviruses that express the N1-BR18 rNAs (see Fig. 1B for the rNA construct design) were produced by GenScript Inc ...
-
bioRxiv - Microbiology 2021Quote: ... and B.1.351 spike cDNA was synthesized (Genscript, Piscataway, NJ, USA). Pseudoviruses were generated in BHK-21/WI-2 cells using a pseudotyped ΔG-GFP (G*ΔG-GFP ...
-
bioRxiv - Microbiology 2021Quote: dCTP deaminase and dGTPase genes used in this study were synthesized by Genscript Corp ...
-
bioRxiv - Microbiology 2021Quote: ... The hexΔ116-2C construct was produced by inserting a 32-residue codon optimized cc-hex coding sequence followed by a linker (resulting peptide: GELKAIAQELKAIAKELKAIAWELKAIAQGAG; linker: GSGSYFQSNA Genscript) at the 5’ of the CV-B3 2C coding sequence ...
-
bioRxiv - Microbiology 2021Quote: ... plasmids (pNW2301 and pNW2305 respectively) were synthetically produced by Genscript ™ ...
-
bioRxiv - Microbiology 2021Quote: ... pH 7.5) containing 3 % (w/v) skim milk powder and incubated with a rabbit anti-SLPMh 133-147 primary antibody (GenScript, Leiden, Netherlands), diluted 1:200 in TBS (10 mM TRIS ...
-
bioRxiv - Microbiology 2021Quote: Polyclonal Rabbit antibodies against the potential S-Layer protein of A_DKE were generated by GenScript Biotech B ...
-
bioRxiv - Microbiology 2021Quote: ... coli and chemically synthesised (GenScript) into plasmid pET-28a(+) ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 variant spike constructs with N- and C-terminal flag tags were produced and cloned into a pcDNA3.1 vector by GenScript Biotech (Piscataway ...