Labshake search
Citations for GenScript :
151 - 200 of 718 citations for ETS Related Transcription Factor Elf 3 ELF3 Antibody HRP since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... at 30 °C in YP medium supplemented with adenine and either 2% raffinose (inducible G1 replication system) or 2% glucose (sporadic G1 replication system) and synchronized in G1 by adding α-factor (MPIB core facility or GenScript RP01002) to a final concentration of 0.5 µg/ml for bar1Δ cells or 10 µg/ml for BAR1 cells ...
-
bioRxiv - Immunology 2024Quote: ... 1% non-essential amino acids and were treated with macrophage colony-stimulating factor (m-MCSF, GenScript, Cat # Z02930-50, 40 ng/ml) for 6-7 days with media change every three days to differentiate bone marrow cells into mouse bone marrow-derived macrophages (BMDMs).
-
bioRxiv - Cancer Biology 2021Quote: CerS5 and CerS6 knock-out clones of DLD-1 cells were generated using the LentiCRISPR v2.0 system with guide RNAs (gRNAs; CerS5; 5’-GCTTGTCCTGATTCCTCCGA-3’ and CerS6; 5’-GGCTCCCGCACAATGTCACC-3’) purchased from GenScript (Piscataway, NJ USA). DLD-1 cells were transiently transfected using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... pLentiCRISPR v2 plasmids that contained predesigned guide RNA targeting mouse ATP2C1 (KO, 5′-TGATGCCGTCAGTATCACTG-3′) and scrambled control guide RNA (SCRM, 5’- AAACCAAAGAGCCGAAGAAC-3’) were obtained from GenScript (Piscataway, NJ). These plasmids were then transfected into Min6 using Lipofcetamin 3000 (Invitrogen) ...
-
bioRxiv - Biophysics 2024Quote: ... nucleotide sequence 5’ GCA GTG CTC CAA AGC GGA TTT CGC 3’) of mSca-containing DuProSense with PLpro cleavage sites (Supporting Table 3) (GenScript Biotech (Singapore) Pte ...
-
bioRxiv - Biophysics 2024Quote: ... nucleotide sequence 5’ CTG AAA GGC GGC GCG CCG ACC AAA 3’) of mSca-containing DuProSense with Mpro cleavage sites (Supporting Table 3) (GenScript Biotech (Singapore) Pte ...
-
bioRxiv - Biochemistry 2021Quote: ... which contained an intact 3’UTR (GenScript, Piscataway, NJ). Two concentrations of Zfp36l1 (WT and mutant ...
-
DeFrND: detergent-free reconstitution into native nanodiscs with designer membrane scaffold peptidesbioRxiv - Biophysics 2024Quote: ... and eluted with 3 x Flag peptide (GenScript, RP21087), concentrated using an Amicon™ Ultra-4 centrifugal filter (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... Diluted 1:5000 horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (cat no. A00160; GenScript) and diluted 1:5000 HRP-conjugated goat anti-rabbit IgG (cat no ...
-
bioRxiv - Developmental Biology 2023Quote: ... Wild type or a mutant version of the human PDX1 enhancer with 6 CisBP predicted RFX binding motifs mutated (Weirach et al 2014) were commercially synthesized by Genscript (Genscript USA, Piscataway, NJ) and cloned into the pGL4.23 firefly luc2/miniP vector (Promega E8411) ...
-
bioRxiv - Biochemistry 2021Quote: ... coli expression (Supplementary Table 3) and synthesized in vitro (Genscript). For protein expression ...
-
bioRxiv - Plant Biology 2022Quote: ... and AtNLP1-3 were codon-optimized and synthesized by Genscript, NJ ...
-
bioRxiv - Molecular Biology 2023Quote: The published DARPin TM-3 sequence22 was synthesized by GenScript and cloned into a pST50 expression vector27 with N-terminal 6x His tag using Gibson assembly ...
-
bioRxiv - Molecular Biology 2023Quote: ... All utrophin 3’UTR reporter constructs were generated by GenScript Biotech (Leiden ...
-
bioRxiv - Neuroscience 2024Quote: ... Urocortin 3 (Ucn3; GenScript USA, Piscataway, NJ: 60pmol/0.4μl/side) was dissolved in DMSO (10% v/v final concentration ...
-
bioRxiv - Microbiology 2022Quote: ... or mouse anti-FLAG antibody (anti-DYKDDDDK antibody, Genscript) with Pierce ECL Western Blotting Substrate (Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2023Quote: The vectors pUC57-[EMCV nt.373-1656] for transcription of wt and mutant EMCV IRES-containing mRNA were made by GenScript and contained a T7 promoter followed by EMCV nt.373-1656 ...
-
bioRxiv - Microbiology 2020Quote: ... and (3 µg) of GFP-tagged S protein (Genscript, MC 0101089). 48 h after transfection ...
-
bioRxiv - Biochemistry 2021Quote: ... GST-Galectin-3 was bound to glutathione-agarose (Genscript, Cat# L00207) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... 2 and 3 (TTCTTCTCTCCTGTCAACAG) were generated in eSpCas9-LentiCRISPR v2 (Genscript). Viral stocks were generated in 293T cells ...
-
bioRxiv - Genetics 2021Quote: ... 3 gRNAs were designed around the SNPs and synthesized by GenScript Inc ...
-
bioRxiv - Microbiology 2021Quote: LAD2 cells (3×105) were exposed to Spike-RBD protein (Genscript) (5 μg/mL) ...
-
bioRxiv - Microbiology 2024Quote: ... The 2-mer and 3-mer oligos were ordered from GenScript USA ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... anti-cGMP antibody (PerkinElmer anti-cGMP antibody: final dilution1:8000, Genscript anti-cGMP antibody ...
-
bioRxiv - Microbiology 2020Quote: ... and then incubated with 45 μL each of 0.1 μg/mL of THE anti-his-HRP (GenScript, A00612) in PBST/BSA for 1 hr at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: The transcription template for the BoxB tethered assay is a derivative of our previously described template and was purchased from GenScript (35). The 5′ UTR was replaced with one of two 5′ UTR sequences possessing varying degrees of secondary structure:
-
bioRxiv - Immunology 2020Quote: ... Commercial antibodies tested also included a human IgG chimeric antibody from GenScript (SARS-CoV-2 spike S1 Antibody (HC2001), GenScript #A02038 ...
-
bioRxiv - Biochemistry 2024Quote: ... wild-type human caspase-3 was synthesized by GenScript (Piscataway, NJ, USA), codon-optimized for expression in E ...
-
bioRxiv - Molecular Biology 2022Quote: ... pGEX4T-1-SUMO1-3 was designed by AJG and made by GenScript by cloning SUMO1-3 cDNA into BamHI and EcoR1 restriction sites ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were then transfected with 3 μg of CXCR3A plasmids (GenScript, OHU18425C) or CXCR3B expression construct (GenScript ...
-
bioRxiv - Microbiology 2023Quote: ... 0.874 mg/mL anti-FimH polyclonal antibody (custom antibody produced by Genscript) or 0.96 mg/mL anti-Muc2 (Novus) ...
-
bioRxiv - Microbiology 2022Quote: ... the PVDF membrane was blocked by 5% skim milk in TBST and incubated with HRP-conjugated streptavidin (GenScript, M00091) for the enhanced chemiluminescence detection ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Detection of the captured human IgGs was performed with mouse anti-human IgG Fab-HRP (Genscript, Piscataway, NJ, USA) (1:5000 dilution in PBS 0.1 % casein) ...
-
bioRxiv - Genomics 2021Quote: ... H2A.X and H2A.Z antibodies are affinity-purified rabbit polyclonal antibodies made by GenScript USA Inc (Piscataway ...
-
bioRxiv - Genetics 2022Quote: The designed 3 pegRNA sequences were synthesized with the pU6 promoter by GenScript and cloned into the lentiviral pHIV-EGFP (Addgene ...
-
bioRxiv - Biochemistry 2023Quote: The 50-residue synthetic peptide used in Figure 3 was synthesized by GenScript USA Inc ...
-
bioRxiv - Genetics 2024Quote: ... 3’ sequence: GTT TTA GAG CTA GAA ATA GCA AGT TAA AAT) (Genscript), amplified with outside primers corresponding to the 5’ constant sequence and the reverse complement of the 3’ constant sequence in 17 cycles using Phusion Polymerase (New England Biolabs) ...
-
bioRxiv - Developmental Biology 2023Quote: An LvSnc5a sequence with the drug-resistant (DR) F1715A mutation was cloned into the pCS2 vector for in vitro transcription (Genscript, Inc. Piscataway, NJ).
-
bioRxiv - Bioengineering 2022Quote: ... Membranes probed with HRP-conjugated secondary were developed with a 3,3’,5,5’-teramethylbenzidine (TMB) substrate (Genscript L0022V or Sigma T0565). Developed membranes were scanned and analyzed with ImageJ (National Institutes of Health) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The blot was incubated with 10 μg/mL pre-biotin-CpOGACD for 1 h at room temperature followed by incubation with streptavidin-HRP (1:5000, M00091, GenScript) for 30 min.
-
bioRxiv - Microbiology 2022Quote: ... The following primary antibodies were used at 1:5000 dilution: anti-FLAG antibody (GenScript), and anti-GAPDH antibody (Proteintech) ...
-
bioRxiv - Pathology 2024Quote: The following primary antibodies were used for western blot: TSP2 Antibody (1:250, GenScript), β-Catenin Antibody (1:500 ...
-
bioRxiv - Plant Biology 2020Quote: ... anti-pT25 OsMKK1 antibody (GenScript), anti-ACT1 antibody (Beijing Protein Innovation) ...
-
bioRxiv - Cell Biology 2023Quote: ... A rabbit polyclonal antibody (Genscript) produced against full-length Drosophila p23 (Q9VH95 ...
-
bioRxiv - Cell Biology 2024Quote: Antibodies were produced by GenScript USA (Piscataway ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Anti-streptag purified antibody (Genscript) was also APC conjugated ...
-
bioRxiv - Cell Biology 2024Quote: Antibodies were produced by GenScript USA (Piscataway ...
-
bioRxiv - Microbiology 2022Quote: ... antibodies for α-Cis1a (GenScript) and α-Cis2 (GenScript ...
-
bioRxiv - Microbiology 2024Quote: Antibodies were produced by Genscript as human IgG1 kappa isotypes ...
-
bioRxiv - Biochemistry 2024Quote: ... Antibodies were procured from GenScript with human Fc domains and stored in 1X TBS pH 7.4 ...