Labshake search
Citations for GenScript :
101 - 150 of 718 citations for ETS Related Transcription Factor Elf 3 ELF3 Antibody HRP since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: Specific treatment conditions were as follows: GPCR activation – Cells were treated with α-factor peptide hormone (Genscript) at 3μM final concentration ...
-
bioRxiv - Cell Biology 2021Quote: ... exponential cells growing in YPDA medium were synchronized with 15 μg/ml α-factor (GenScript Cat. No:RP01002) for 2h at 25 °C ...
-
bioRxiv - Developmental Biology 2021Quote: ... The α8β1 peptide inhibitor following the 23-mer sequence PRGDVFIPRQPTNDLFEIFEIER (Sato et al., 2009) was commercially generated (Genscript) and used at a 10 μM working concentration ...
-
bioRxiv - Immunology 2020Quote: ... The iKIR (DTHFRTFRSHSDYRR) and scrambled-KIR peptide control (DTHFARTFARSHSDYRRI) were obtained from GenScript (Piñeros Alvarez et al., 2017). A lipophilic palmitoyl group was added to the N-terminus of both sequences to facilitate cell penetration (Waiboci et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... followed by Goat Anti-Mouse IgG [HRP] (1:3000; GenScript A00160) as the secondary ...
-
bioRxiv - Biochemistry 2020Quote: ... Blots were developed using HRP conjugated Goat anti-mouse IgG (Genscript) and luminata crescendo (Millipore) ...
-
bioRxiv - Molecular Biology 2023Quote: ... A horseradish peroxidase (HRP) labeled secondary against the His tag (Genscript) was added at a 1:5,000 dilution in 3% BSA in TBS-T ...
-
bioRxiv - Immunology 2023Quote: ... was constructed based on the sequence Fc.Mut24 published by Khoryati et al.13 The protein was manufactured by Genscript, using its proprietary CHO mammalian expression system ...
-
bioRxiv - Genetics 2024Quote: ... and bam 3’UTR by Genscript, Inc (Piscataway ...
-
bioRxiv - Biochemistry 2020Quote: ... Templates for sgRNA transcription were generated by PCR amplifying synthesized fragments (IDT and Genscript) or by annealing a T7 primer oligo to a single stranded template oligonucleotide ...
-
bioRxiv - Immunology 2024Quote: ... All segments were cloned into a bi-directional transcription plasmid derived from pUC57 (Genscript) including polymerase (Pol ...
-
bioRxiv - Bioengineering 2024Quote: In-vitro transcription (IVT) was performed to synthesize mRNA from template plasmid DNA (GenScript) that had been linearized using the BspQI enzyme ...
-
bioRxiv - Bioengineering 2024Quote: In-vitro transcription (IVT) was performed to synthesize mRNA from template plasmid DNA (GenScript) that had been linearized using the BspQI enzyme ...
-
bioRxiv - Microbiology 2021Quote: ... Wildtype 3’UTR and 3’UTR coding sequences containing all 16 editing mutations were synthesized commercially (Genscript). Forward primers were designed to add the T7 promoter gactcgtaatacgactcactataggggaagag at the 5’ end ...
-
bioRxiv - Cell Biology 2023Quote: ... The 14-3-3 permanent bind forms of Hdac4 fragments of Hdac4-3R18 were synthesized by Genscript. The shRNA lentivirus vector for 14-3-3 isoforms ...
-
bioRxiv - Plant Biology 2020Quote: ... and probed with HRP-conjugated mouse anti-rabbit (1:10,000, Genscript, #A01856) and horse anti-mouse (1:5000 ...
-
bioRxiv - Plant Biology 2022Quote: ... followed by secondary Goat Anti-Mouse IgG [HRP] (1:3000; A00160, Genscript). Proteins were detected with SuperSignal West Femto Maximum Sensitivity Substrate (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... and detected with MonoRab™ Rabbit Anti-Camelid VHH Cocktail [HRP] (Genscript), diluted 1:500 in blocking buffer.
-
Modifications in the T arm of tRNA globally determine tRNA maturation, function and cellular fitnessbioRxiv - Molecular Biology 2023Quote: ... which were detected after incubation with 120 ng/mL streptavidin-HRP (Genscript) in hybridization buffer for one hour ...
-
bioRxiv - Biochemistry 2024Quote: ... Blots were subsequently washed and incubated with HRP-Protein G (Genscript #M00090) for one hour ...
-
bioRxiv - Microbiology 2020Quote: ... stable GFP expression by GAS was created by synthesizing the ribosomal binding site (RBS) and gfp gene from pDCerm-GFP (Ly et al., 2014) into the pUC57 plasmid (GenScript), resulting in pUC57-RBSGFP plasmid ...
-
bioRxiv - Biochemistry 2021Quote: Human DHFR cDNA fragments were inserted into the pTR1412 vector (Geffen et al., 2016) in frame after the URA3-HA-GFP fusion (Genscript). Full-length DHFR was expressed in yeast from pTR1412 lacking the URA3-HA-GFP fusion (Genscript) ...
-
bioRxiv - Immunology 2021Quote: ... with a C-terminal 8XHis-tag was sub-cloned in pCMV as previously described (McCallum et al., 2020).The SARS-CoV-2-RBD-Avi construct was synthesized by GenScript into pcDNA3.1-with an N-terminal mu-phosphatase signal peptide and a C-terminal octa-histidine tag ...
-
bioRxiv - Genetics 2022Quote: ... The open reading frame of frq bearing 84 phosphomutations (frq84A) from (Baker et al. 2009) was custom-synthesized and purchased from Genscript, and to frq84A ...
-
bioRxiv - Immunology 2022Quote: ... vector (published in Chen et al., Immunity 2014) with the insertion of a sgRNA backbone vector (pUC57-U6-sgRNA, Genscript). CHOP-CHOP website (source ...
-
bioRxiv - Biochemistry 2023Quote: S- and MB-COMT cDNA were codon optimised for expression in human cells and inserted into an integrative VAMP-seq expression vector (Matreyek et al., 2018) fused to GFP (Genscript). Singlesite variants were generated by Genscript ...
-
bioRxiv - Biochemistry 2023Quote: ... To generate a destination vector for the DHFR-PCA, a Gateway cassette was inserted at the C-terminus of DHFR[F3] in pGJJ045 (Faure et al., 2022) (Genscript). GCK was cloned into the pDEST-DHFR-PCA destination vector using Gateway cloning (Invitrogen) ...
-
bioRxiv - Immunology 2023Quote: ... and were codon-optimized for human cell expression and made in the CMV/R vector (Barouch et al. 2005) by Genscript with a C-terminal hexahistidine affinity tag ...
-
bioRxiv - Immunology 2023Quote: ... DNA encoding 2DS1 (3-200) and 2DS4 (3-200) were synthesized and cloned into pET28c by Genscript (USA). Plasmid encoding 2DL1 (1-224 ...
-
bioRxiv - Biochemistry 2023Quote: ... and at the 3’ end with 293 bp actin 3’ UTR followed by 500 bp of Tb927.7.6110 3’ UTR was synthesized by Genscript. The same construct containing a blasticidin-S deaminase (BSD ...
-
bioRxiv - Genomics 2022Quote: ... G1 synchronization was achieved by incubating 700 ml of exponentially growing (OD600 0.2) bar1 cells with a final concentration of 5 ng/ml of alpha-factor (GenScript RP01002) for 3 hours ...
-
bioRxiv - Synthetic Biology 2024Quote: ... An elongation factor EF-P (GeneFrontier Corporation) and synthesized SKIK peptide dissolved in nuclease-free water (94.6% purity, GenScript, Tokyo) was added to achieve a final concentration of 1 µM and 100 µM ...
-
bioRxiv - Cell Biology 2023Quote: ... Adherent cells were then cultured with complete maturation media (RPMI-1640 with 10% FBS, penicillin/streptomycin, 10 ng/ml macrophage colony-stimulating factor (M-CSF) (Genscript) for 5 days for monocyte-derived macrophages (MDM ...
-
bioRxiv - Developmental Biology 2021Quote: ... flanked by duplicated copies of the 250bp chick B-globin HS4 insulator (Allen and Weeks, 2005; Rankin et al 2011) was commercially synthesized (Genscript USA) and cloned into the ApaI/XhoI sites of pBluescript II KS+ (Agilent 212207) ...
-
bioRxiv - Molecular Biology 2020Quote: All VH and Vκ sequences used were described previously (Ling et al., 2018) and codon optimized using GenSmart™ Codon Optimization (Genscript) online software ...
-
bioRxiv - Neuroscience 2022Quote: We generated the UAS-syt1GCaMP6F construct by cloning the cDNA sequence of Drosophila synaptotagmin 1, a 3x GS linker, and the GCaMP6F sequence into the pJFRC7-20XUAS vector (Pfeiffer et al., 2010) (Genscript Biotech). The GS linker connects the C-terminus of syt1 to the N-terminus of GCaMP6F (after Cohn et al. ...
-
Varying recombination landscapes between individuals are driven by polymorphic transposable elementsbioRxiv - Genomics 2024Quote: pAct5C promoter and the mCherry coding sequences were synthesized and cloned into pBS-KS-attB1_2 vector (obtained from DGRC, stock number 1322; (Venken et al. 2011)) by Genscript (Piscataway, NJ). Plasmid with TE sequences downstream of mCherry was obtained by cloning PCR amplified transposons into BamH1-digested pBS-KS-attB1-2 _pAct5C_mCherry plasmid using Takara infusion technology (https://www.takarabio.com) ...
-
bioRxiv - Plant Biology 2021Quote: cDNA stretches corresponding to the 3’ UTR region of TCV genomic RNA (5’-CAACUGAGGAGCAGCCAAAGGGUAAAUUGCAAGCACUCAGAAU-3’) were obtained from GenScript [26] ...
-
bioRxiv - Microbiology 2020Quote: ... Horseradish peroxidase (HRP) labeled-mouse anti-human IgG-Fc specific (GenScript No. A01854) diluted 1:10,000 in PBST was added (100μl/well ...
-
bioRxiv - Cell Biology 2024Quote: ... Blots were developed using the Lumi Sensor Chemiluminescent HRP Substrate kit (Genscript USA) and SuperRX Fuji medical X-Ray films (Fuji FILM Europe).
-
bioRxiv - Immunology 2020Quote: ... plasmid that contained predesigned guide RNA targeting Adar1 (5’-CTTGTCCGTCAAGTACCAGA-3’) and a pLentiCRISPR v2 plasmid that contained predesigned guide RNA targeting Adar2 (5’-AGTACCGCCTGAAGAAGCGA-3’) were obtained from GenScript. These plasmids were then transfected into Raw 264.7 cells using a Neon Transfection System (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2021Quote: ... sequences flanked by overhangs for Gibson Assembly matching the vector insertion site (5’-CCGCATGCTTAATTAAGAAGGAGATATACAT-3’) – array sequence – (5’-GACTACAAGGATGACGACGACAAG-3’) were synthesized (Genscript) and obtained in a pUC57-Kan vector ...
-
bioRxiv - Biochemistry 2024Quote: ... The column was washed with 15 mL TBS and eluted with 3 mL of 150 µg/mL 3×FLAG peptide (Genscript) in TBS ...
-
bioRxiv - Neuroscience 2024Quote: ... using the CHOPCHOP online tool (Labun et al., 2019) and pre-tested in vitro using a GenCrispr sgRNA Screening kit (Fig S3A;L00689; GenScript, NJ, USA) before insertion into vectors ...
-
bioRxiv - Immunology 2022Quote: ... 3) TCRα-CD3δ crosslinking: mouse anti-cMyc (Genscript) and rabbit anti-FLAG (Genscript) ...
-
bioRxiv - Bioengineering 2024Quote: ... and 3 U/mL erythropoietin (all from Genscript). Cultures were allowed to continue for an additional 2 weeks and then imaged and scored again ...
-
bioRxiv - Molecular Biology 2023Quote: ... radiodurans (Supplementary Table 3) were synthesized by GenScript, along mini-Tn elements containing a chloramphenicol resistance gene ...
-
bioRxiv - Neuroscience 2021Quote: ... Detection of blot was carried out with a LumiSensorTM HRP Substrate Kit (GenScript Technology).
-
bioRxiv - Cancer Biology 2024Quote: ... and diluted 1:5000 HRP-conjugated goat anti-rabbit IgG (cat no. A00098, GenScript) were used as secondary antibodies ...
-
bioRxiv - Cell Biology 2023Quote: ... Blots were developed using the Lumi Sensor Chemiluminescent HRP Substrate kit (Genscript, United States) and SuperRX Fuji medical X-Ray films (Fuji FILM ...