Labshake search
Citations for GenScript :
451 - 500 of 718 citations for ETS Related Transcription Factor Elf 3 ELF3 Antibody HRP since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: The following commercial antibodies were used: FLAG (A00187, GenScript, mouse, 1:1000); HA (11867423001 ...
-
bioRxiv - Microbiology 2023Quote: Custom polyclonal antibodies specific for AmpC and OprD were generated by GenScript. The epitopes for each are listed in Supplemental file 2 ...
-
bioRxiv - Immunology 2023Quote: ... Specific anti-SCV2 immunoreactivity was detected using a SCV2 nucleoprotein antibody (Genscript) at a 1:1000 dilution ...
-
bioRxiv - Genomics 2022Quote: ... All ChIP-nexus experiments were performed using antibodies custom generated by Genscript: Zelda (aa 1117-1327) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... THE™ His Tag mouse antibody (GenScript, Nanjin, China; diluted 1: 2000) was used as the primary antibody ...
-
bioRxiv - Biochemistry 2022Quote: ... DARPins were detected with rabbit anti-FLAG antibody (GenScript, A01868; 1:5,000) and goat anti-rabbit-AP antibody (Sigma-Aldrich ...
-
bioRxiv - Immunology 2023Quote: ... supernatants containing monoclonal antibodies were purified using Protein A magnetic beads (Genscript), and the purified samples were verified by SDS-PAGE.
-
bioRxiv - Genetics 2023Quote: ... scapularis Kenny custom antibody used in this study was generated by Genscript. Rabbits were immunized three times with 0.2 mg of tick Kenny immunogen (amino acids 223-356) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... using an anti-Histidine-tag primary antibody (Genscript A00186; 1:3000 dilution) and an IR800 conjugated secondary antibody (Li-Cor Biosciences) ...
-
bioRxiv - Immunology 2024Quote: ... MYD88 polyclonal antibodies of Chinese tongue sole were synthesized by GenScript (China).
-
bioRxiv - Microbiology 2024Quote: ... Total eIF2α and Gcn4 levels were detected with custom-generated antibodies (GenScript) raised in rabbits exposed to full-length recombinant protein ...
-
bioRxiv - Neuroscience 2024Quote: ... samples were incubated with a custom anti-Panx2 antibody (1:200, GenScript) overnight at 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Protein G Magnetic Beads were pre-incubated with V5 antibody (A01724, Genscript) for 4 h and crosslinked with 10 volumes of crosslinking buffer containing 20 mM DMP (3 mg DMP/ml of 0.2 M Boric Acid pH 9 ...
-
bioRxiv - Biochemistry 2024Quote: ... the membranes were incubated with the relevant primary antibody anti-FnCpf1 (GenScript), anti-LbCpf1 (Millipore) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pL7-PfSMC3-3HA-glmS plasmid also contained the homology repair construct 5’- AGATAGAGAGAGTTATATATCTAAAGGAACAAAGAATGAGGCCTACGAAATTATTAGC ATTGTATAAAAAAAAAAAGAAAAAAAAAAGAAAAAAAAAAAAGATTATATATATAAT ATATGTTGACAATTAATAAATATATTTGTATATATCTGTTAACTAATTATGAAAATTTTT GAATCAATAAATTTTTTAAATAACAAAAAAAAAAAAAAATATATATATTATATATATA TTTTATATTTTATATTTTCTTGTAATTTTTGTTTTTTTAGGAGGAAAAACATGCCCTAGA AAATggcggtggaTACCCTTACGATGTGCCTGATTACGCGTAtCCcTAtGAcGTaCCaGAcTAtG CGTACCCtTAtGAcGTtCCgGATTAtGCtcacggggtgTAAGCGGCCGCGGTCTTGTTCTTATTTT CTCAATAGGAAAAGAAGACGGGATTATTGCTTTACCTATAATTATAGCGCCCGAACTA AGCGCCCGGAAAAAGGCTTAGTTGACGAGGATGGAGGTTATCGAATTTTCGGCGGATG CCTCCCGGCTGAGTGTGCAGATCACAGCCGTAAGGATTTCTTCAAACCAAGGGGGTGA CTCCTTGAACAAAGAGAAATCACATGATCTTCCAAAAAACATGTAGGAGGGGACAACA ATTTGGTTTTGTTTTTTTCTTTAGGTTTTGAGAAAAACAAATAGGAAATACAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAATGTATTTTTACATATGCACTTGGATTA TTTTATTTTTATTATTTTTCTTTATATAAAGTAAAAATATACATAAGTATGCTTATTTATT ACATAAGAGTTTATTTAAGAAAGGTTTCTTTTTCATAATATTGTGTGCATGAGTTTTTTT TTATTTTATTTTTTTTTTTTATTTCTGTAACGAAAAGGATATTAAAAAAAATAATAAAA- 3’ (synthesized by GenScript Biotech [Piscataway, NJ, USA]). This homology repair construct comprises a 3 x Hemaglutinin (3HA ...
-
bioRxiv - Cancer Biology 2021Quote: ... The primary antibodies used were, anti-p-Smurf2Thr249 (#J1683BA260-5, 1:2000) (GenScript), anti-Phospho-Smad2 (Ser465/467 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and a rabbit polyclonal antibody specific for calmodulin-binding peptide (A00635-40, GenScript), a Goat anti-Rabbit IgG (H+L ...
-
bioRxiv - Cell Biology 2021Quote: ... and a mouse monoclonal antibody to detect GAPDH (clone 3B1E9, GenScript A01622–40) were used at a dilution of 1:1,000 in blocking buffer ...
-
bioRxiv - Cell Biology 2021Quote: The antibodies used were: monoclonal anti-His THE HIS Tag (GenScript, Piscataway, NJ); monoclonal anti-HA (BioLegend ...
-
bioRxiv - Microbiology 2020Quote: ... Antibody against nucleocapsid protein of anti-SARS-CoV-2 N protein (Genscript, USA) and GAPDH of anti-GAPDH (Proteintech ...
-
bioRxiv - Microbiology 2021Quote: ... using primary antibodies specific for MeV F HRC (rabbit polyclonal, Genscript, 503028-1) and 6xHis tag (rabbit polyclonal ...
-
bioRxiv - Microbiology 2021Quote: ... using primary antibodies specific for MeV F HRC (rabbit polyclonal, Genscript, 503028-1) and 6xHis tag (rabbit polyclonal ...
-
bioRxiv - Microbiology 2020Quote: ... Custom primary peptide antibody generated in rabbits against ICP1 capsid (Gp122, YP_004251064.1) (GenScript) was diluted 1:1500 ...
-
bioRxiv - Microbiology 2021Quote: ... Mouse anti-CodY IgG monoclonal antibody (IgG) was generated and purified (Genscript, USA).
-
bioRxiv - Bioengineering 2022Quote: ... 20D5 and 16A11 antibodies were extracted from the sequencing results provided by GenScript PROBIO ...
-
bioRxiv - Microbiology 2022Quote: ... The primary antibody for Western blot is Mouse-anti-His mAb (GenScript, Cat.No.A00186). The concentration was determined by BCA protein assay with BSA as a standard ...
-
bioRxiv - Biophysics 2022Quote: ... for 2 minutes followed by 20 μM biotinylated FLAG-tag antibody (A01429, GenScript) for 30 minutes ...
-
bioRxiv - Bioengineering 2022Quote: The following primary antibodies were used: goat anti-HA (1:250; GenScript, A00168), rabbit anti-HA (1:500 ...
-
bioRxiv - Cell Biology 2022Quote: ... were permeabilized with 0.2% Triton-x100 and incubated with anti-RAP1 antibody (Genscript) at 4°C ...
-
bioRxiv - Immunology 2020Quote: ... and IgA antibodies in the rhesus serum standard: anti-S1 RBD (Genscript #HC2001), anti-S2 (SinoBiologicals #40590-D001 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 50 μl of 0.25 μg/ml primary rabbit anti-SNAP antibody (GenScript, USA) was added and incubated for 1 h at RT ...
-
bioRxiv - Developmental Biology 2020Quote: ... Antigen for the custom anti-Nrl antibody (commissioned from Genscript, Piscataway, NJ, USA) was recombinant protein matching the C-terminal 112 amino acids of zebrafish Nrl (residues 301-412 of GenBank ...
-
bioRxiv - Immunology 2021Quote: ... Large-scale culture of supernatants and purification of antibodies was performed by Genscript.
-
bioRxiv - Molecular Biology 2020Quote: ... blocked with 5% milk and probed with C-Myc antibody (Genscript A00173-100), Rad53 antibody (Abcam ab104232) ...
-
bioRxiv - Biochemistry 2021Quote: ... The antibody variable domains of hybridomas 8E11 and 9C6 were sequenced by Genscript.
-
bioRxiv - Cell Biology 2024Quote: Protein lysates were incubated with 1 µg mouse anti-V5 antibody (Genscript A01724) for 2 h at 4°C ...
-
bioRxiv - Bioengineering 2024Quote: ... GAPDH was detected using an antibody purchased from Cell Signaling (Cat#97166S) and ORF1 and ORF2 were detected using antibodies generated by GenScript. Finally ...
-
Development of monoclonal antibody-based blocking ELISA for detecting SARS-CoV-2 exposure in animalsbioRxiv - Microbiology 2023Quote: ... A cPass™ SARS-CoV-2 Neutralization Antibody Detection Kit (GenScript, Piscataway, NJ) was used and the test was performed following the instructions of the manufacture ...
-
bioRxiv - Genomics 2022Quote: ... Antibodies from each rabbit were purified and quantified individually (Genscript BioTech; Piscataway, NJ).
-
bioRxiv - Genomics 2023Quote: CUT&Tag was performed with mouse anti-HA antibodies (1:100, Genscript #A01244), rabbit anti-H3K4me3 antibodies (1:100 ...
-
bioRxiv - Genetics 2023Quote: ... scapularis Relish monoclonal custom antibody used in this study was generated by Genscript. Mice were immunized three times with 0.2 mg of the tick N-Rel immunogen (Rel homology domain ...
-
bioRxiv - Immunology 2024Quote: Antibody heavy and light chain genes were codon-optimized and synthesized by GenScript, separately inserted into vector plasmids (pCMV3-CH ...
-
bioRxiv - Immunology 2024Quote: ... Antibody heavy chain VDJ and light chain VJ gene cassettes were synthesized (Genscript) and cloned into rhesus IgG1 (RhCMV-H) ...
-
bioRxiv - Developmental Biology 2024Quote: Three affinity-purified rabbit antibodies against SpInsc were made by Genscript (Piscataway, NJ).
-
bioRxiv - Molecular Biology 2020Quote: ... The protein complexes were detected by western blot with anti-His antibody (Genscript, A00186) and anti-Flag antibody (Sigma ...
-
bioRxiv - Immunology 2021Quote: ... Specific anti-CoV immunoreactivity was detected using a SARS-CoV-2 nucleoprotein antibody (Genscript) at a 1:1000 dilution ...
-
bioRxiv - Developmental Biology 2020Quote: ... A primary antibody specifically for zebrafish was used to detect Esco2 (1:1000, GenScript). Alexa 546 anti-rabbit (1:1000 ...
-
bioRxiv - Microbiology 2020Quote: ... EsxA and SodA were generated for this study (Customer’s Antigen Polyclonal Antibody Package, Genscript). C-terminally his6-tagged SiEsaA41-871 ...
-
bioRxiv - Systems Biology 2021Quote: ... cell were stained overnight at 4°C with SARS-CoV-2 N-antibody (Genscript) at a dilution of 1:500 in PBS + 1% BSA+ 1%FBS ...
-
bioRxiv - Microbiology 2021Quote: ... Western blot using a mouse anti-Histidine tag monoclonal Antibody (Genscript Cat. No. A00186) was used to confirm purity of the purified protein (Figure-1S) ...