Labshake search
Citations for Takara Bio :
251 - 300 of 808 citations for Saporin Chicken Polyclonal affinity purified Alexa488 labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... His-tagged recombinant proteins were isolated by 1 h incubation with Talon metal affinity resin (Clontech) at room temperature ...
-
bioRxiv - Genomics 2020Quote: ... and Living Colors DsRed Polyclonal Antibody (rabbit anti-E2-Crimson, Clontech [now Takara Bio USA] ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-DsRed (rabbit polyclonal, 1:500, Clontech, Cat# 632496, RRID: AB_10013483); anti-EGFR (goat polyclonal,1:100 ...
-
bioRxiv - Neuroscience 2020Quote: ... and rabbit polyclonal anti-Ds-red (1:200; Clontech, Cat#632496). Secondary antibodies included Cy2 goat anti-mouse (1:400 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and/or mCherry (Living Colors DsRed Polyclonal Antibody #632496, Takara, Japan) after in situ hybridization were carried out as described in (Chen Q et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... Living Colors Polyclonal anti-Pan-RCFP (rabbit, 1:500, Clontech 632475), anti-GFP (chicken ...
-
bioRxiv - Cell Biology 2021Quote: ... Living Colors Polyclonal anti-mCherry/dsRed (rabbit, 1:500, Clontech 632496), Living Colors Polyclonal anti-Pan-RCFP (rabbit ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-dsRed (Living Colors DsRed Polyclonal Antibody, 1:250, Clontech). Secondary antibodies were Alexa 488 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The antibody used was rabbit polyclonal DsRed (632496; TaKaRa, 1:500).
-
bioRxiv - Molecular Biology 2021Quote: ... The supernatant was then mixed with 50 µL cobalt beads (TALON® Metal Affinity beads Clontech, 635502) prewashed three times in guanidium hydrochloride buffer and the samples incubated at RT for 3 h with rotation ...
-
bioRxiv - Cell Biology 2019Quote: ... The supernatant was pH’ed to 7.6 and mixed with 1 ml Talon Metal affinity resin (Clontech 635509) for 30 min ...
-
bioRxiv - Microbiology 2019Quote: ... and the supernatant was applied to 1 mL of pre-washed TALON metal affinity resin (Takara Clontech) at 4°C ...
-
bioRxiv - Microbiology 2019Quote: ... and the supernatant was applied to 1 mL of pre-washed TALON metal affinity resin (Takara Clontech) at 4°C ...
-
bioRxiv - Bioengineering 2019Quote: ... The supernatant was transferred into a new tube with 400 μl of Talon metal-affinity resin (Clontech), equilibrated with phosphate buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cleared lysate was bound to 3 mL (=1.5 mL bed volume) Talon SuperFlow Metal Affinity Resin (TaKaRa) per protein preparation ...
-
bioRxiv - Microbiology 2022Quote: ... The concentrated supernatant was passed through an equilibrated TALON Metal Affinity Resin (Takara Bio Inc, Shiga, Japan). The column was washed with 10 volume of PBS containing NaCl (300 mM ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated overnight with 0.5 ml of Talon (immobilised metal affinity chromatography, IMAC) resin (Clontech) in the presence of 150 mM NaCl and 20 mM imidazole ...
-
bioRxiv - Cell Biology 2023Quote: ... The supernatant was collected and allowed to bind with TALON® Metal Affinity Resin (Clontech Laboratories #635503) for 1 hour at RT with rotation ...
-
bioRxiv - Biochemistry 2024Quote: ... Lysate was filtered using a 0.25 µm syringe filter and applied to Talon metal affinity resin (Takara) in 50mM Tris-HCl ...
-
bioRxiv - Biochemistry 2022Quote: ... probes labeled with [α-32P] dCTP by random priming (Takara, cat# 6045) were hybridized to the membrane in PerfectHyb Plus Hybridization buffer (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... The reverse complementary RNA probes were 5’ end-labeled with digoxin (TaKaRa). Hybridizations and washes were carried out using DIG Block and Wash Buffer (Roche) ...
-
bioRxiv - Biophysics 2023Quote: ... 5′-Cy5 and 3′-Cy3 labeled ITS2 RNA was synthesized from Takara Biomedical Technology ...
-
bioRxiv - Developmental Biology 2023Quote: ... primary antibodies (chicken anti-GFP, Abcam, ab13970, 1:2000 and rabbit anti-DsRed, Clontech, 632496, 1:200) were incubated overnight at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... then transferred to drop of GFP polyclonal antibody (TaKaRa, Cat. No. 632592) at 1:50 for 1 h and subsequently in second antibody conjugated with 18-nm gold particles (Jackson ...
-
bioRxiv - Neuroscience 2022Quote: ... VTA slices were incubated with rabbit anti-dsRed polyclonal antibody (632496, Takara) as the primary antibody (1:1000 dilution ...
-
bioRxiv - Neuroscience 2022Quote: ... we used primary polyclonal rabbit anti-tdTomato from Takara (Cat no. 632496) and secondary anti-rabbit goat Cy3 (Cat no ...
-
bioRxiv - Immunology 2021Quote: ... Protein eluted from the Strep-Tactin column was then applied to pre-equilibrated TALON Metal Affinity Resin (Takara) and allowed to enter the column by gravity flow ...
-
bioRxiv - Plant Biology 2022Quote: ... Purification of His-tagged proteins was carried out using His-tag affinity resin (His-resin) (Clontech, CA, USA).
-
bioRxiv - Immunology 2020Quote: ... The clarified extract was loaded onto a column containing TALON Metal Affinity Resin (BD Clontech, Mountain View, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... The supernatant was applied to a TALON® metal affinity resin column (Takara Bio, Mountain View, CA, USA), and the column was washed with 10 column volumes of wash buffer (50 mM Tris-HCl ...
-
bioRxiv - Microbiology 2024Quote: ... The supernatants from the samples were added to 0.5 ml of a Talon metal affinity resin (Clontech, USA) equilibrated with binding buffer ...
-
bioRxiv - Genetics 2022Quote: ... ISH was performed using digoxigenin-labeled oligonucleotide lnc-WAL probe (TCAGCACTGTCATCATTACATT) (Takara, Japan) according to previous literature(Liu et al. ...
-
bioRxiv - Biochemistry 2024Quote: Target RNA was labeled at the 3′ end using Poly(A) Polymerase (Takara) and [32P]cordycepin-5′-triphosphate ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples were incubated with chicken anti-GFP 1:1000 (Aves) and rabbit anti-DsRed 1:500 (Clontech/Takara) antibodies diluted in blocking solution overnight at 4°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples were incubated with chicken anti-GFP 1:1000 (Aves) and rabbit anti-DsRed 1:500 (Clontech/Takara) antibodies diluted in blocking solution overnight at 4°C ...
-
bioRxiv - Biophysics 2019Quote: ... purified using cobalt resin from Clontech Laboratories ...
-
bioRxiv - Neuroscience 2020Quote: ... before addition of 4 mM imidazole and incubation on a rotor (111 RPM) with TALON metal affinity resin (Takara, Cat.# 635503 ...
-
bioRxiv - Biochemistry 2021Quote: ... The cell lysate was centrifuged at 40,000 × g for 45 min at 4 °C and the supernatant was loaded onto a cobalt affinity column (Clontech). After washing the column with 20 bed volume of 20 mM HEPES pH 7.5 ...
-
bioRxiv - Biochemistry 2021Quote: ... The lysate was clarified at 26,915 x g for 50 minutes at 4°C and then incubated with TALON metal affinity resin (Clontech). His-Nsp15 was eluted from the resin with 250 mM imidazole ...
-
bioRxiv - Biophysics 2021Quote: ... The supernatant was isolated by centrifugation at 160,000 g for 30 min and incubated with TALON superflow metal affinity resin (Clontech) at 4 °C overnight ...
-
bioRxiv - Biochemistry 2021Quote: ... prepared as described above was mixed with imidazole (5 mM) and 0.5 mL of Talon superflow metal affinity resin (Clontech) that had been equilibrated with buffer (as above for magnetic agarose) ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysate was clarified at 26,915 × g for 50 minutes at 4°C and then incubated with TALON metal affinity resin (Clontech). His-Thrombin-TEV-Nsp15 variants were eluted with 250 mM imidazole and further purified by gel filtration on a Superdex-200 column (GE Healthcare ...
-
bioRxiv - Biophysics 2021Quote: ... The resulting supernatant was collected by ultracentrifugation (150,000 × g, 1 hour, 4 °C) and applied onto an immobilized metal-ion affinity chromatography column (Talon, Clontech) equilibrated with 40 mM Tris ...
-
bioRxiv - Immunology 2021Quote: ... The supernatants were collected and applied to a column filled with 5 ml of TALON Metal Affinity resin (Takara) previously equilibrated with ice-cold PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... Purification of 6X-Histidine tagged cavin proteins was done using TALON metal affinity resin (ClonTech, Scientifix Cat No. 635503). Talon resin was thoroughly washed with 500GF buffer containing 5 mM imidazole to remove detergent and non-specifically bound proteins ...
-
bioRxiv - Microbiology 2021Quote: ... The supernatant with the soluble His6-UppH was loaded on to a 3 ml TALON Metal Affinity Resin (Clontech) equilibrated in binding buffer (50 mM Na2HPO4 ...
-
bioRxiv - Microbiology 2021Quote: ... the supernatants were loaded onto a column containing TALON® Metal Affinity Resin (635501; Takara Bio, Inc., Shiga, Japan). The resins were washed with lysis buffer and the His-tagged proteins were eluted with elution buffer (20 mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2022Quote: ... Tagged proteins were bound to 6 (=3 mL bed volume) or 3 mL (=1.5 mL bed volume) pre-equilibrated Talon SuperFlow Metal Affinity Resin from TaKaRa (LarA wt ...
-
bioRxiv - Biochemistry 2024Quote: ... The other 2A proteins were separated from the lysate using immobilized metal affinity chromatography with either TALON beads (Clontech) or chelating Sepharose beads charged with NiCl2 (Cytiva) ...
-
bioRxiv - Neuroscience 2021Quote: ... using anti-DsRed (1:500; RRID:AB_10013483; Living Colors DsRed polyclonal; Takara Bio USA). Tissues were rinsed ...