Labshake search
Citations for Takara Bio :
451 - 500 of 808 citations for Saporin Chicken Polyclonal affinity purified Alexa488 labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... Pol γA was expressed in sf9 cells and purified on TALON (Clontech) and Superdex200 size exclusion columns ...
-
bioRxiv - Bioengineering 2020Quote: ... PCR products were purified and ligated into the pMD19-T Vector (TakaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: Purified proteins or polymers were diluted using 1× PBS (Takara Bio, T900), and loaded into custom-made microneedles prepared with the P1000IVF micropipette puller (Sutter Instrument) ...
-
bioRxiv - Plant Biology 2020Quote: ... total RNA was extracted from leaves and purified using RNAiso Plus (TaKaRa) according to the manufacture’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... gel-purified and utilized for transformation of Stellar competent cells (Takara Bio) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Purified product was digested with BamHI and SalI restriction endonucleases (TAKARA, Japan) and sub cloned in BamHI and SalI site of pCDNA3.1/myc-His(A ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR product was purified using MiniBEST agarose gel DNA extraction kit (TaKaRa). Following DpnI digestion of the template at room temperature overnight ...
-
bioRxiv - Immunology 2022Quote: ... Purified DNA was PCR amplified using PrimeSTAR Max (Takara-Clontech, Shiga, Japan) for the variable V4 region (using 515F-806R barcoded primers ...
-
bioRxiv - Immunology 2022Quote: ... Purified DNA was PCR amplified using PrimeSTAR Max (Takara-Clontech, Shiga, Japan) for the variable V4 region (using 515F-806R barcoded primers ...
-
bioRxiv - Molecular Biology 2019Quote: ... The modified BACs were purified using a Nucleobond BAC 100 kit (Clontech). BAC quality was assessed by digestion with RsrII and SbfI (New England Biolabs) ...
-
bioRxiv - Microbiology 2019Quote: ... The modified BACs were purified using the NucleoBond BAC 100 kit (Clontech).
-
bioRxiv - Cancer Biology 2019Quote: Resulting PCR products were gel purified and cloned using InFusion kit (Clontech) into an expression vector containing fabp10a promoter sequence ...
-
bioRxiv - Cancer Biology 2019Quote: Resulting PCR products were gel purified and cloned using InFusion kit (Clontech) into an expression vector containing fabp10a promoter sequence ...
-
bioRxiv - Molecular Biology 2022Quote: ... DNA was purified using the NucleoBond Xtra BAC kit (Takara Bio 740436.25) and stored at 4°Cfor less than one week before delivering to mESCs.
-
bioRxiv - Microbiology 2022Quote: ... products were gel-purified using Nucleospin gel and PCR Clean-up (Takara), and the sequences were determined by EuroFins Scientific.
-
bioRxiv - Synthetic Biology 2022Quote: ... The PCR products were purified using NucleoSpin PCR clean-up kit (Takara).
-
bioRxiv - Neuroscience 2022Quote: ... Lentiviruses were purified and concentrated using the LentiX Concentrator (Clontech, PT4421-2) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2023Quote: ... cDNA was amplified and purified using an Advantage 2 PCR Kit (Clontech). The cDNA library was sequenced using an Illumina sequencing platform (NovaSeq6000) ...
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant CML13 and CML14 were purified via Ni-NTA His60 (Takara Biosciences.) and CaM7 using phenyl-sepharose (Sigma Aldrich ...
-
bioRxiv - Plant Biology 2023Quote: ... the fusion protein was purified using TALON® Cobalt resin (Takara Bio). Following extensive washing in a buffer containing 20 mM HEPES (pH 7.5) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Total RNA was extracted and purified using NucleoSpin (Takara Bio, Shiga, Japan), following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... His-tagged proteins were purified with His60 Ni Superflow resin (TaKaRa; 635677) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Purified lymphocytes were homogenized in RNAiso Plus (Takara Bio Inc., Kusatsu, Japan) and stored at -80 °C until use ...
-
bioRxiv - Cancer Biology 2023Quote: ... then DNA was purified using a PCR cleanup spin column (Takara #74609). The sequencing library preparation was performed using NEBNext Ultra II DNA kit (#E7645S) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The constructed plasmids then were purified using nucleospin plasmid-transfection grade (TAKARA) and transfected into piezo1-deficient N2A cells (Sugisawa et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... while cDNA insert was purified using NucleoSpin® Clean-up Kit (Takara). Insert generation was performed by High-Fidelity PCR using primers designed to yield fragments containing exons 1-10 or 12-16 with the necessary overlap ...
-
bioRxiv - Cell Biology 2024Quote: ... genomic DNA was purified with Terra™ PCR Direct Genotyping Kit (Takara), followed by PCR amplification and Sanger sequencing of specific genomic regions encompassing the target site.
-
bioRxiv - Neuroscience 2024Quote: ... AAV2/9 particles were purified using the AAV Purification kit (Takara, Japan). The AAV solution was concentrated to the optimal volume by centrifugation using an Amicon Ultra-4 100k centrifugal filter unit (Millipore) ...
-
bioRxiv - Microbiology 2024Quote: ... The band was extracted and purified with Nucleospin Gel Extraction Kit (Takara). The gel-purified DNA was then further purified with Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2024Quote: ... Viruses were extracted and purified by using an AAV extraction kit (Takara).
-
bioRxiv - Molecular Biology 2024Quote: ... forward = TTTCTAAGACTCTCTCCCGTA and reverse = GATTAGAAGTAGCCGACCAA) was labeled with dCTP [α-32P] using Random Primer DNA Labeling Kit Ver.2.0 (Takara, catalog #6045). The hybridization was done at 65°C overnight in Church and Gilbert Moderate Hybridization Buffer (1% BSA ...
-
bioRxiv - Developmental Biology 2021Quote: ... The final BAC was purified with Nucleobond BAC 100 Kit (Takara Bio, 740579) and co-injected with 1 nl of 40 ng/ul tol2 mRNA into one-cell stage embryos ...
-
bioRxiv - Developmental Biology 2021Quote: ... The final BAC was purified with Nucleobond BAC 100 Kit (Takara Bio, 740579) and co-injected with 1 nl of 40 ng/ul tol2 mRNA into one-cell stage embryos ...
-
bioRxiv - Immunology 2019Quote: ... All constructs were purified from supernatants by passage over Cobalt-TALON resin (Takara) followed by gel filtration chromatography on Superdex 200 Increase (GE Healthcare ...
-
bioRxiv - Neuroscience 2022Quote: ... Collected lentiviral particles were purified with lenti-X concentrator (Clontech, Mountain View, CA).
-
bioRxiv - Molecular Biology 2021Quote: ... The PCR product was purified with NucleoSpin Gel and PCR Clean-up (Takara) and digested with AsiSI at 37 °C overnight ...
-
bioRxiv - Neuroscience 2021Quote: RNA was purified from iPSCs and hMOs using a NucleoSpin RNA kit (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... Then the purified RNA was reversed transcribed using RT-PCR Kit (TaKaRa, Japan) with an oligo dT-adaptor primer in accordance with the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNAs bound by miR-2861 were purified with Trizol reagent (Takara, Shiga, Japan), and assessed through qRT-PCR.
-
bioRxiv - Microbiology 2022Quote: ... The purified fiber was treated by adding proteinase K (PK) (Takara ST 0341) to 20 µL of sample (200 ng as estimated by dsDNA Qubit fluorometric quantification ...
-
bioRxiv - Plant Biology 2022Quote: ... The concentrated supernatant was purified using His60 Ni Superflow resin (TaKaRa, California, USA) on a BioLogic LP system (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... The BAC16 ORF20 mutant was purified using the NucleoBond BAC 100 kit (Clontech). iSLK cell lines latently infected with the KSHV ORF20STOP virus were then established by coculture ...
-
bioRxiv - Microbiology 2020Quote: ... Monoclonal antibodies were purified from hybridoma culture supernatants using Thiophilic-Superflow Resin (Clontech) or Ab-Capcher MAG2 (ProteNova ...
-
bioRxiv - Microbiology 2021Quote: ... The amplicon was purified by NucleoSpin® Gel and PCR Clean-Up (Takara) for Sanger sequencing.
-
bioRxiv - Cancer Biology 2022Quote: ... DNA was purified using the NucleoSpin Gel & PCR Clean-up Kit (Takara, 740986.20) and 100 bp paired end reads sequenced using Illumina NovaSeq at the Integrated Genomics Operation at MSKCC ...
-
bioRxiv - Biochemistry 2021Quote: ... The recombinant proteins were purified with His60 Ni Gravity Column Purification Kit (Clontech) following a manufacturer’s protocol ...
-
bioRxiv - Physiology 2019Quote: ... The purified DNA fragments were ligated into the pET-32a (+) plasmid (TaKaRa, Japan) and transformed into competent Escherichia coli DH5α cells ...
-
bioRxiv - Neuroscience 2021Quote: RNA was purified from iPSCs and hMOs using a NucleoSpin RNA kit (Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The AAVs were purified with AAVpro® Purification Kit (Takara Bio, Shiga, Japan). When feeding HFD was started ...
-
bioRxiv - Immunology 2020Quote: ... Purified RNA was reverse transcribed using PrimeScript™ RT Master Mix (RR037A; Takara) according to the manufacturer’s protocol ...