Labshake search
Citations for Takara Bio :
651 - 700 of 2841 citations for PCR Master Mix since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2022Quote: Reverse transcription PCR (RT-PCR) was performed with 500 ng RNA per reaction by TaKaRa PrimeScriptTM RT Master Mix (Perfect Real Time ...
-
bioRxiv - Developmental Biology 2023Quote: Linear DNA fragments were amplified via PCR using CloneAmp HiFi PCR premix (Takara Bio, 639298). PCR products were cut from agarose gels and purified using the Nucleospin gel purification kit (Takara Bio ...
-
bioRxiv - Genomics 2023Quote: ... The RT-PCR products were treated with NucleoSpin Gel and PCR Cleanup kit (Takara Bio) and directly analyzed using Sanger sequencing (Eurofins Genomics) ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was amplified by 15 cycles of PCR using the Advantage 2 PCR Kit (Clontech) with template switching custom oligo (TableS6) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Linear DNA fragments were amplified via PCR using CloneAmp HiFi PCR premix (Takara Bio, 639298). PCR products were cut from agarose gels and purified using the Nucleospin gel purification kit (Takara Bio ...
-
bioRxiv - Genomics 2019Quote: The 90-μL preparation volume for PCR contains 1X Advantage 2 PCR Buffer [not short amplicon (SA)](10X, Clontech, 639206, Advantage® 2 PCR Kit), 0.4-mM dNTP Mix (50X/10 mM ...
-
bioRxiv - Developmental Biology 2021Quote: ... the RNA-protein mix was catalyzed by proteinase K (Takara, 9034) at 55 °C for 1 h ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were transfected with the LentiX VSV-G transfection mix (Clontech) and different SARS-CoV-2 ORFs (cloned into pLX vector) ...
-
bioRxiv - Developmental Biology 2019Quote: ... 5μl of RT mix containing 1× SMART First Strand Buffer (Clontech), 2 mM dithiothreitol (Clontech) ...
-
bioRxiv - Cancer Biology 2019Quote: ... using SYBR green qPCR Mix (TaKaRa Bio Inc., Otsu, Shiga, Japan). Expression level of miRNA was normalised to U6 small nuclear RNA ...
-
bioRxiv - Systems Biology 2020Quote: ... The cDNA was then amplified by Advantage Polymerase Mix (TAKARA, 639201) with IS primer (5’-AAGCAGTGGTATCAACGCAGAGT-3’) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... or using the In-Fusion HD cloning enzyme mix (Clontech, 638911). Plasmids were grown in E.Cloni 10G Chemically Competent Cells (Lucigen ...
-
bioRxiv - Cell Biology 2020Quote: ... The Smartscribe RT mix also contained: 1ul Smartscribe reverse transcriptase (Clontech), 2ul 5x Smartscribe First-Strand Buffer (Clontech) ...
-
bioRxiv - Microbiology 2020Quote: ... and 5 µL of the ligation mix (Takara Ligation Kit 6023), and then placing the tubes into a heat block at 90 °C for 15 min ...
-
bioRxiv - Genomics 2020Quote: ... 3μl of reverse transcription (RT) mix was added (0.475μl SmartScribe [Takara] ...
-
bioRxiv - Genomics 2019Quote: ... 1-mM SMARTer Kit dNTP Mix (10 mM each; Clontech, 634936), 1.2-μM SMARTer Kit SMARTer II A Oligonucleotide (12 μM ...
-
bioRxiv - Genetics 2020Quote: ... qPCR was performed with the SYBR Fast qPCR Mix (Takara, RR430A) in the Applied Biosystems 7900 Real-Time PCR System ...
-
bioRxiv - Genomics 2023Quote: ... The enzyme mix (PrimeScript II Reverse Transcriptase, catalog num. 2690A, Takara) was prepared as follows ...
-
bioRxiv - Cell Biology 2023Quote: ... were co-transfected with Lentiviral High Titer Packaging Mix (Takara Bio) and the lentiviral plasmid (pLVSIN-PIP-FUCCI or pBOB-EF1-FastFUCCI (Addgene ...
-
bioRxiv - Developmental Biology 2023Quote: ... using TB green pre-mix Ex-Taq II (Cat#RR208, Takara) and KiCqStart SYBR green primers (Sigma Merck ...
-
bioRxiv - Cancer Biology 2023Quote: ... to 7.5μL eluted RNA 2.5μL smRNA mix 1 (Takara Cat. #635031) and 1μL 10uM UMI RT primer (seq ...
-
bioRxiv - Bioengineering 2023Quote: ... with iPS cell Generation Episomal vector Mix (Takara Bio, Shiga, Japan) and Amaxa Human CD34+ Cell Nucleofector kit (Lonza ...
-
bioRxiv - Molecular Biology 2024Quote: ... cerevisiae strain JOS003 using the Quick and Easy Transformation Mix (Clontech). JOS003 is a strain in which the one endogenous EIF4E gene has been replaced by homologous recombination with a KanMX4 cassette ...
-
bioRxiv - Genetics 2020Quote: ... The PCR products were purified by Nucleospin® Gel and PCR Clean-up (740609-250; TAKARA).
-
bioRxiv - Genetics 2020Quote: ... eas and RhoGEF) for qRT-PCR were generated by PCR using Tks Gflex DNA Polymerase (TaKaRa) and gene-specific primers (Table S1) ...
-
bioRxiv - Cancer Biology 2019Quote: ... PCR amplification was performed using a CloneAmp™ HiFi PCR Premix (Takara, Mountain View, CA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... Quantitative real-time PCR (qRT-PCR) was performed using a SYBR Premix Ex Taq Kit (Takara) and a real-time PCR machine (CFX96 ...
-
bioRxiv - Microbiology 2020Quote: ... Both 1st PCR and 2nd PCR were performed by using PrimeSTAR HS DNA polymerase from Takara Bio ...
-
bioRxiv - Neuroscience 2020Quote: ... A 10,143 kb fragment was amplified by PCR in a thermal cycler (TaKaRa PCR Thermal Cycler) using the following primers ...
-
bioRxiv - Microbiology 2019Quote: ... and reverse transcription-PCR (RT-PCR) was carried out with a PrimeScript RT reagent kit (TaKaRa). The primers used for RT-PCR are listed in Table 3 ...
-
Biosynthesis of Circular RNA ciRS-7/CDR1as Is Mediated by Mammalian-Wide Interspersed Repeats (MIRs)bioRxiv - Molecular Biology 2019Quote: ... the first PCR reaction mixture (30 cycles) was purified with a PCR cleanup column (Takara Bio) and the eluate was used for the second PCR reaction (30 cycles) ...
-
bioRxiv - Pathology 2021Quote: ... Mycoplasma contamination was confirmed by PCR using the TaKaRa PCR Mycoplasma Detection Set (Takara, Shiga, Japan).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Transcription template DNA fragments were amplified directly by PCR using PrimeStar Max PCR polymerase (Takara Bio), SPu-2 (5’–CAGTAAGCCAGATGCTACAC ...
-
bioRxiv - Microbiology 2021Quote: ... two to four overlapping DNA fragments were PCR amplified (Advantage HF 2 PCR Kit from Clontech) using primers described Table S4 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Two PCR amplicons were prepared in each case using CloneAmp™ HiFi PCR Premix (638500; Clontech) and were then gel-eluted using NucleoSpin® Gel and PCR Clean-up (740609.10 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... PCR products were purified using a NucleoSpin Gel and PCR Clean Up Kit (Takara Bio Inc.). Cycle sequencing reactions were performed directly using the two PCR primers using the BigDye Terminator version 3.1 Cycle Sequencing Kit (Applied Biosystems ...
-
bioRxiv - Biochemistry 2021Quote: ... The PCR product was purified using a NucleoSpin Gel and PCR Clean-up kit (Takara Bio), and Sanger sequencing was performed using primers 134 ...
-
bioRxiv - Cancer Biology 2021Quote: ... PCR and quantitative-PCR were performed with Takara Taq Hot Start Version (TaKaRa Biotechnology, Shiga, Japan) or Power SYBR Green PCR master mix (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... Linkers and the T7 tag were added using PCR and the CloneAmp HiFi PCR Premix (TakaRa). Mutants (N127143Q and motif substitutions ...
-
bioRxiv - Microbiology 2020Quote: ... Mutants (N127143Q and motif substitutions) were obtained by mutagenesis PCR using CloneAmp HiFi PCR Premix (TakaRa). The GFP-tagged N127143Q mutant was constructed by substitution of asparagines for glutamines at amino acids 127 and 143 by site-directed mutagenesis (Stratagene) ...
-
bioRxiv - Immunology 2020Quote: ... PCR samples were indexed with Nextera Illumina Indices reads using the Advantage 2 PCR kit (Clontech) in a 8 PCR cycle reaction and purified with Agencourt AMPpure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR was performed with the One Step TB Green PrimeScript RT-PCR Kit II (TaKaRa), and SYBR Green was used as a fluorescent dye for detection ...
-
bioRxiv - Genomics 2020Quote: ... Used cDNA template was further split into two PCR reactions with Terra PCR Direct Polymerase (Takara) with the following program 98°C for 2min ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... PCR products were purified with Nucleospin Gel and a PCR purification kit from TAKARA (Cat: 740609). Illumina sequencing adaptors were added to respective samples with PCR using the same primers and protocols similar to the barcode amplification ...
-
bioRxiv - Microbiology 2020Quote: ... CloneAmp Hi-Fi PCR Premix (Takara) and the following PCR conditions were used to generate the amplicons ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR-amplified from pEGFP-C1 (Clontech), at the NheI-XhoI sites of the pCI-Neo vector and then by adding the fragment encoding GIGYF2 at the XhoI-NotI sites ...
-
bioRxiv - Bioengineering 2019Quote: ... with CloneAmp HiFi PCR premix (Clontech). The additional variants G462N/W/L/C/I/F/A/H/Y were generated using the Q5 and QuikChange site directed mutagenesis kits ...
-
bioRxiv - Cell Biology 2021Quote: ... and PCR Clean-Up Kit (Takara) then In-Fusion (Takara ...
-
bioRxiv - Cell Biology 2021Quote: ... or CloneAmp HiFi PCR Premix (Takara)) and sequences of plasmids were confirmed by Sanger sequencing (Microsynth ...
-
bioRxiv - Microbiology 2021Quote: ... 1× ExTaq PCR buffer (Takara, Clontech Laboratories ...